$ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 10:30:52  &.(6HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?YS4:oGyn!!GIɪr}d"?T~̦äL5S-0K .O h32FPDթڠ`tDt>"@죌yq*nX[A&GFJHi~I*NEDrW!7N"$I(EKAqSs 4 ~nTMͺCK]ߠmV;o?dYٕ78~U[b1Ҽ"vͯoc?EعQXgR)Kͮ,}?z)LM'G yc଱{~ϧ <aZy5 }(`-8o9tnsc#s \= Ϭ=Iٽ|z+e k]D>\w#>Z#s$;kWUfEݓOﱁQ3Zٳҵ͂3?RΌWbfukZ[KΫ?2P.qzK趟QEոn fK?/V-eh [q-tC 5ߜrlԗcPOuv?]Is k@Vhj\1UG6IXts&:>ZL:VGq6A|L-g"dtfkZOɵ&ƴp<[?LsO巟jr.k 7!G }bCoJ Lt,ĵVGz#88Z9X\s(<*0)onfK#;h}^z魥 in8ݳfkʹYڅtZ[ȭ3ֹrvlF@$V(ӥLUKSGc3; qlsv@X~ޥԱf}Z;OSP cpu6~-`Mw\NQkZΆ<Y/sq28C@C[Tq).h;oUΦpdJuee㷥}[=?gy{G;sh-r׶IyS"ZX2ϵ,q,_P3dvNKZiy5۬ݓx<.>r^CKƺawi$P-VWvwQ s\c] C[%X{*mϼ買{kͷk}ߤ[I$#e |N.hPb]XqN/]MCvEʿCO;.Kb\:2H o^ց.o~^,ُٞjkmO1Kl{\^RmjW!ػfnM^@ϳӲ܆{+aS sCƐG=;zX:exqeUWnYYg"Ɔ#Urc }&oz&_վ_N=J̛*55k^s,OIK_uK#mE@BZݪj׏\6"֑F5MCAS l|~@$?~*s|è܍"8BVV lrLk mN;\AwZCK~ekX}Zʬ c9k?afE_pmY=M@p^ Sa;ݕx??(xLj%6 eyS?6>ieLo='ĵ@H\/Qβ̐\ =7l54Z k.{; vk4~3 gsnU8}F cINeZr1mL7[Kv,6VGM)"~g9-g?1ig==v@_a#{g*Wff!ώ4";! Kjvo4Ā]Gbao")voyQ2AޟS8l.'WXI$|% inFUu s΍݉u9HtZ]G"/32CZcZew7q2 :g,h>eQM/ig4~޿OdWo kF-ۭʪgɷ:E%ƟҴH obs"j.-pmm?C1:0 zZ7,8o`4w3wo-M:H9 f#@ՌBLJ>Nv{7kX_El,-2+F{Adm ncn՛IU;[Hi\rZu얃m44V\\AnݭoVX]`E;hka[gL0'G~SZLju^v04=;sU,۸q cL5%Ui.7y΁߽N'YZYY^ZEth B h6l4o{V?{ŗvm}{!$#]J/vEUR,:ߥzպ{3x"֬=q#I;1¼PIv;$o~D,\zUZ(}0GeO1`1|#غ_m?nu7q[is,ޯEwWh.cDk>6dٺױ !?u/0bԨkm }[>kpq{I?jCQF]ckq`!k.Y{{%Tbvu. 8cnsp>X諭H58elcK ^q;2LjVKtvO%c>{X|vu (mhvϳ]}uβ>?֎Ů3+(9e1OWN/q<>451 im7B^sFݶ?Z8v=xOO?p]TEc#?L w9-\fcNCeЙH#g(^rs4h߼S` qK$jjvE$n'A/paw.-9W!>˙_Uud#=;^?⯏01WZ2]G֫m̨ܡEoY)D/饮ߏ`8u68Juy9]_>̬3km%oݞQbni0ܽcZKm,tr%#aCgozsb$W}B׳wQg}DV03sQ[> &}-=Ή-wGOT|?<׌dKƒIOqh}+{0$_q"cJΝ'm;1xbH>#I)x:I)7F#F"@죌yq*nX[A&GFJHi~I*NEDrW!7N"$I(EKAqSs 4 ~nTMͺCK]ߠmV;o?dYٕ78~U[b1Ҽ"vͯoc?EعQXgR)Kͮ,}?z)LM'G yc଱{~ϧ <aZy5 }(`-8o9tnsc#s \= Ϭ=Iٽ|z+e k]D>\w#>Z#s$;kWUfEݓOﱁQ3Zٳҵ͂3?RΌWbfukZ[KΫ?2P.qzK趟QEոn fK?/V-eh [q-tC 5ߜrlԗcPOuv?]Is k@Vhj\1UG6IXts&:>ZL:VGq6A|L-g"dtfkZOɵ&ƴp<[?LsO巟jr.k 7!G }bCoJ Lt,ĵVGz#88Z9X\s(<*0)onfK#;h}^z魥 in8ݳfkʹYڅtZ[ȭ3ֹrvlF@$V(ӥLUKSGc3; qlsv@X~ޥԱf}Z;OSP cpu6~-`Mw\NQkZΆ<Y/sq28C@C[Tq).h;oUΦpdJuee㷥}[=?gy{G;sh-r׶IyS"ZX2ϵ,q,_P3dvNKZiy5۬ݓx<.>r^CKƺawi$P-VWvwQ s\c] C[%X{*mϼ買{kͷk}ߤ[I$#e |N.hPb]XqN/]MCvEʿCO;.Kb\:2H o^ց.o~^,ُٞjkmO1Kl{\^RmjW!ػfnM^@ϳӲ܆{+aS sCƐG=;zX:exqeUWnYYg"Ɔ#Urc }&oz&_վ_N=J̛*55k^s,OIK_uK#mE@BZݪj׏\6"֑F5MCAS l|~@$?~*s|è܍"8BVV lrLk mN;\AwZCK~ekX}Zʬ c9k?afE_pmY=M@p^ Sa;ݕx??(xLj%6 eyS?6>ieLo='ĵ@H\/Qβ̐\ =7l54Z k.{; vk4~3 gsnU8}F cINeZr1mL7[Kv,6VGM)"~g9-g?1ig==v@_a#{g*Wff!ώ4";! Kjvo4Ā]Gbao")voyQ2AޟS8l.'WXI$|% inFUu s΍݉u9HtZ]G"/32CZcZew7q2 :g,h>eQM/ig4~޿OdWo kF-ۭʪgɷ:E%ƟҴH obs"j.-pmm?C1:0 zZ7,8o`4w3wo-M:H9 f#@ՌBLJ>Nv{7kX_El,-2+F{Adm ncn՛IU;[Hi\rZu얃m44V\\AnݭoVX]`E;hka[gL0'G~SZLju^v04=;sU,۸q cL5%Ui.7y΁߽N'YZYY^ZEth B h6l4o{V?{ŗvm}{!$#]J/vEUR,:ߥzպ{3x"֬=q#I;1¼PIv;$o~D,\zUZ(}0GeO1`1|#غ_m?nu7q[is,ޯEwWh.cDk>6dٺױ !?u/0bԨkm }[>kpq{I?jCQF]ckq`!k.Y{{%Tbvu. 8cnsp>X諭H58elcK ^q;2LjVKtvO%c>{X|vu (mhvϳ]}uβ>?֎Ů3+(9e1OWN/q<>451 im7B^sFݶ?Z8v=xOO?p]TEc#?L w9-\fcNCeЙH#g(^rs4h߼S` qK$jjvE$n'A/paw.-9W!>˙_Uud#=;^?⯏01WZ2]G֫m̨ܡEoY)D/饮ߏ`8u68Juy9]_>̬3km%oݞQbni0ܽcZKm,tr%#aCgozsb$W}B׳wQg}DV03sQ[> &}-=Ή-wGOT|?<׌dKƒIOqh}+{0$_q"cJΝ'm;1xbH>#I)x:I)7F#F ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$:dB}7·Zl铭9LĠW,I*4`HAPF(nͮI'dhUiI'DcsW I+- U^-VxxuJHtDpP@&ۤ%]$SsX?ge%-ʈRI$,$AJ:TNZT$hRI$ud9&bI!' ) TI))AI)I$+TˆRjIY$I3Nܤ$II$IH'L&N$I%)$I:d%)$R$p,$I$RI$I$I:I$:dQLTTQK铤:d'NR )I)I$I$3I)I )$ ]$NI"$I$I)I$tI%)2t$I)I$I'IJI$$2JRI$2I$$I$I)I'LI$$I$I)I$I$JRI$:IRI$&I%)$NI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$0+Y͇O ’I)ʑa#N)I$$*=9I0Z7K6ro$) ?P _ JE4(' 'J\irM )xI02BIBhO$ %)$I-%*RI4&2tBx)$$I$Pd$[Lp JRI$ ҄! RTnRhçLG)J.iJS5Cx> o@蒒ҤAMw-'i)bvM6)*  a%2%D#R)(#T)%tĦJFg𥴁k bUmĕiͪmj3[Z=\>' OvEy|k9 K1TxYQϓwzsZNe^ Vޙ> /<0Kw7G?^wSBè ?T<ԕ.ILeJ5!cG Hy"G*Gj%At|6<ԫSP~?*C_?цCQ:8|^#PU|jQw* @". !&w-]g9GrX`F,u۱gT pc n⧎$ZhY: ͗icXp<@ F2y :4@@sY"cX (kkKBu7Ѩ Okjd qME s˄4cuw o5 &! jA=U[Z=K=:+#7h!ڂGW^L $֗vEkc܋Smq]=(AHYn ¯2{5sχ2m &NGhͥ:BvDjѯo~=xV͞pM$l&M 5(Y95 6fk;nY9&fOfN\LĈ.y:u}#[:ǒҺ{pi \uq*9Pv'Q;&uF2Ps!E"a&4y“Z]Cpq8Tp;y(TCy =#T^# Xc )!mтlI_+^i6bu=1W9:q\@+..Yh*mz#- hi*;*Xhon 3hP܃6D}J jRerv˓A$vCqHuS¯[Sc3k-euG»~Ah``&6wD/ոy!z/L{}%vYUOi9UZKدQM`:NCoq eZL?suEdzdn5 w@c㯇tj.0Flh[@LȄ(%]kX+f|BCd^ƺ iS^ xYvUV{\ŧ6ߟwi>K<>ep_sK/wx|{kPr-OG"?"MVcPIM 6 Q8c~ 9O vkeV;o3+UZH*Iy:\#n; Y=3>q港˙ZY#^ڂ4^u֓Ma5|];j0!Z7[3`*#V* Ȯ Y zhus $8G\RA}S<~ EzG܋㵄[ d`ܟ Z5wilM|V?V!Q!iuKFP?X]kUx=lr龎M߾ONdU_j#T)t):LG.(ḺhBhV/oJJs{5JǎS}]J4@nt_mX0=)JJU?G-'< ׅ֍R[iJنV[ul^fF$6)UߓZA7(;R9@JcƝAVcf !$DT%YEDG4U(V;Grv5JL*sJ 0҄67 ;Ar9<ДaԞҘJt o.;xHB\{'ҝIgQEPT.[<Xy pGM7%f fT Jup!H:,cy%9w!ڪI]vRt RHDDwn$B; BEJnJB˦$Ц9:Ɲ&ʿjqmã=ؾ|{XY}g_~ʔ|]Rv_Խޗ#\a>:bZVS@mުN:&?Qkt 8(ȲdIWϯx*M+L$El4" | I$5iF7r]cv6w)$CHI;D)$R'p;TI+8 adaaE}:A IR}r >_WDW'Lry4E{t7r+I%T*[e-#\*wrmZB$!Q&tB\rI*F uFI$J2LI' BtI$&))I$t%)$H)JJRI$d"$I66$J7@%bUoPl[<6'Le(];^ J'L$IN*/ $8PqB0QPIR)BI$2bI&)ȡI$IBIRI$)$$INJRI$IJI$Q H%I$I'M%)$O)` )I$E$2I'LR ID2BI$JRI$LJRI$I8 A+JI$8I$I:I))I$RdRI$ QBI%4-SEJI$BpTI$pIJI$$dI:I$TI&I")!I$J I:bEJI$\J%1)$QNPI$pJI$$) )I$I*P@*RI$(L\I8 )RI$5E:V I$2p$JJLEI$HڒpVI$LSrJRIN:JRI$'L&N$I%)$NL%)$R$$'I$IJI$I$RI$$(Rd( 1$1NN1I$&N%):I' ItI)dI:g'L䔤II.I'I$RI$I$TI$铤&N$I%)$I:dRI$$JRI$$IJI$I$RN$IJI$I$RI$I2JRI$2t)I$II%)$I2t)I$t'IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$rfRPPЩIA uSQ);XGpW6qAK$%kx'hLjY$+rND830ZXx wJԲg6TJ"N HRJIjL?xJ 7jEò꒟q(Z5iye0k*·)z+SP4\;rl {3COt-+SUO]ò6О;OtʭR6kDghP}oهIK)h(F[e/;Q %aC|T,Ub[▊'%݂ȳ脍Z@VvHm (SWyR%V pP{R6M@~(s"$a-͆i2X8 Bԅb +PJ?r+SDJuB BQSS"쬆n1 ŐϰT&?8j;o#T@ #h`URSZg蠻6">^Z8Q2l`)b1bTjա깢Cd-γW-OMGʺDB}XJA1 ʲX%%\ygPɘDkCCP .s{LDBfʻ %yCQy3GP iR`"LО6-(V?*%9vݦULQe Oޙ>Hv6ς%D|şƐf,Yvh{Rѡ?*U64,[,?"fHGY`/; ?H'VO~]͚v,㲅0k9nߤuJh1*C(DOL$U=uO*Nb!%$$N Ow:p p~ +ڑ V̏YO_ܳ쾚\& r"XU,ܫe nCss{0Sms0dH+3qzV SP nq09K'DW5gRKj(v]cFU*mB<ʮW6n0t*R0Jez{ DŤ26וQC",%́I$mwD ) Ue'vNS '\fQ{=78y)>I 6`i r܆thTY-.[; ==¼R1pk]ILr@k;=ՃEgC2᧊LAi_R[܉ 18{{b{`ʨnB|WfS3¯ O B̈ Bv؉GB}Lʹe&mYofk1si8Yy)D葳on.c>-XXs oGe!)rGzr "$+ZO t(sNA50YFs7 E+6ik}^q p-O,Su YI1 Lq]-tr$A-+Y> +X' gUr.W6rw*$+!w4+k>A8 Q`Cro!6KT~*@Ѿ5&r|d UK򔯍d-%tn+2[V|a m&COGsddBڧw=|OCs&B19S8**zBxMv+ B1q(p-%!xDKj[TЖhSKj+^B};IHSHhE6⡸$ )hl p"KqC)n))cS7]@ET@/)nEHKk@VCBP n2%5--& PGZ- VMtPJqIMV4A4Gme!7P744N1ZLb AV%F#rRA@AT F/h'⪒1*0 b;+RU4ۄ&Q>e1Qw2a6*aegj.|F5uToFA:{GMl_>_ ,{[@Ɲg~ʔ|]R&T~ʔ|]R&RKUL$f '/ mbIBiSpuN*[Q)$U-*`@JiGE'LPk+;[8]AMeU$J ӺFȯn P$IN@::Q*$Qpacl( ,'IDR)d$RM)T)$N:bI()"$I'JRI$$ҒI'JI%)$J$I<$H%I$I'IJI$L)RRI$)7T)4B*RI$1N$JQR!4"$IIJI$ JRI$S$I*.*2QJI$L R)$RI1)I&qQR)! I$$I$2tI:b1IJI$$I)I$ITI&LBdI@R#hRI$4)&))I$e$JRI$xJRI$I4'IJI$%FSL)$SN 9TIIEI4I$pNI*I$)) 줒L&H$tIINT%|$Hd$I$rJY:dI$I8RQ I%ILI$$I' $RI%!IIK'L$I)$I$EJI$I)INTTI LSr"d)bI&I$)tIH'Q I)bI'I$R$t$JRA$A$R$I'AJI$I$RI$N:I$I)dI$I%)$N:I)I$dI%)$I$IJN:dI%)$I$IJI$I$)I$t$I$I$$I$JRI$I$I'L$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%h@M;+xN'JI$I$$RI$q 䱖6o(/Ԣ*@p$I8""5KcI(Ԕ2M[@)Ji쒓%)[RrTO?P*R4rB%L*))*;tID6ҥ:HT& )B~RS$ڋ𢒗v P*]4)&8 )HɓB}MRSLJ}@!)Ü{ UJe?OĤX< Qi>Pw)Z-=A4'mڴih*lffIeL\|Mjv1o&<WZk>d:u0.qΤ\hW[[K <5V?hd}?%\?3QŶX"xB'4-1B'3ז@TgB{hF ]t5=KluI *1=IW3*`}|g 6G(3T6Upwed4pY6u7_i^8j^Qy'6:`R a!%Gnk"M+YSXɪx3Qu5`?BgםJ+El58䔅Fիt'%,l+h`ZIMuZZ4_wXc{*P TUw6xToWpݵy~-S Dektȭ<(=,E.?Fp视'w M~UN(X욘uAuRq`HpS 9LH ԁ(*ay y(9S>~ՏpSe%HJ; *L;IϒN³+{q4Jsk = Xq%ܕkx|Q a'8YK5_UaѢ$igދӨ! Q@Ǫ.Xb 0 VXϙ)z$H(n7ztTrraϰ'R~c1L J {}OefJM`;#:$AWok^C C/)Ҫf^lher,yGt&s ;(XKJ֑MM,$%+mf3=:o!\BnK͛4WL †CC%;!b >x"ߐX7wu<;6HlX մѫ[]՜{u:05Ps%~m}'^+;wsߣ)| B#U{J'{9DyQ }nŇi6){)h e xˎD{bUa:=>DC=R5 aeMx5zUvKq hsh,v^'v*bX]j11o߂!"<I(U?QV(iq3^J=VUk㢸JI8dۻ[%y'O708AB|g鴝BTq#_Gi:q:ݤyTJI.B9@rkd7o'摈N ,+px)9=lh|NcC+OߒnNlW'1ZNÑd~]kty?b&<]—ۻX_K|U6VϿ8SN&6 Hl'a";µsH=ҾKt+੼hY/J6W%_Loj3z֟lGRn`0~,ޮ'oĬݡjqo,³/=\wXP 2z@RԡI$ȹ)Qa"$[(LsaH RRS2]!@Q8Mʓ%$RQk yL mLIK9I6$\;NJxN%3r`S蘄I)RM-IKRM %iS)O0NH tALO0I6Lt e"S$h Jd@OdBNF@NRRJJI(ptऒܘd@KAdSMdI%,2t:b*RdJR$ne8))IE8!FQi)i!KRSJ bS$)&T$ПsJ]$(%.$JB`(uh|F=vWI2m5| )gYV1~ʴ|]RR_TJ>.z2Q/,|$IMb $"TTd謱0H@^ ] $J^U,"!c.S]t5T2['B+UT4BZ8Je-t'TX5A R54Nᥦ5I%\⃪Ws :)$M۪8;ܣë-ZI%IVI($z(ĩ$#N'/ !@B]$&5Tmwa\:X{v:B6TI*MÔGj-V%+LRI$Hr &$Ga3jʓRI$!8RpBHRI$$A*I$H$I$$JRI$"TRRI$I2(RI$)@)%)$V񕒫c+',TTĘQئ rxA$L*&f'N**2HN)HI$rN+JE0E RI$)O)IJI$a9 0I)RA*I$hN tIE:E2JRI$:d)I$P$JI$IJI$!0jtRI$$IJI$$E%)$Q*%HI)H&NRI$H($IJTe"I*I$H')5)$OŒʓR RI$'M PI(r%)$S B RI$tIRI$E$BI$$JRI$$ $I$I)I$I$JRI$RLRBI%(I$I(rRRI$Qܑ)8)$HHht)$O) SRI$ID' )$R)Q Ѥ$NE2{>iARdt2pI% _(aRRI$d2pVI$rI;t$H$$I’RIJL2dI%)$I:I$$JA$I)I$I$ RI$I$I'H&NR'LVZJRg'LD")$b:I)tI8 )dI:II$)$RR $RI$I$tRI$I$I:I$I$I%dI:dBI$铦IJI$I$RI$I$铦I$RI$I$I$$$I$I)I$I$JRI$I$I$I$$I$I)I$tI%)$I$$$II$I$I%)$I$IJI$I$RI$)$I,B()t%o I$$I$I)I$pX?o * (AT5'6] b?`$R)SD EKDiP{C&ʜT'ZctQTEh4QiLIV[EmnWam ]9Q5[ n$#D$Ս?4`>_ژ6Op;*ۘR*IO9ⲱn 4mh·lU4'E6_`͙)hs`U &60qʪ<:?ʛӚF.wPwNs.|ybaGy}I/ x#]Uxg-`.1Ȓ+fzuhԤ:AQ}6Ws3?wЏK6HZ+mSYM|Kp$ NFʫiZ Mؤ8 nZ H; Jm%N T 8P kIvU+us>V;(CuJr- }!d…6\n;{ ΃+߼#Wc> x+1fq>*ÝX2{y6?YΑYWV^PkvZ&S ]gO-&@(L|ʬYsZa{y|UnvJ x4 D YwUew`5(́ƣUj(lnL >n1L"Uښ_diGaLwӫfi}`4Os=PA l{,= Mk)~<2 %E{{I<#O@y*,lW4aZ(ϭF"0Vm9}:x[qUeivnq0gnKs"c1$h|qꫧײT/Mၥr6=$wM]:@D,uI@3ecOt6rD[ ^ Id7몏-e8mo`?N"` f"Owe!lSC2ѩBy'@dT eЙLZ5YYѯUIg`aH%wG}Y<}5x*Kj"" Z6F7Ĕgh2Cš(`;^oA;Bb\OrG<44~X}g!Aǚ2̧-8za(0RM QCN>r'%(Vin+6]I="s+7ԀɊrx A+J6~)a^#ڊrDmLYPT<# gXtAsrD<+B_Y1h5@ԡd*~ !k~u8~je[k[ME3@>«X q1%)'W B<)-! ']>R kN;/VeyjAh+=,>HuW2 0> Eu<◊ѿ1x#BoU-{UVýT .^z.+w9 ƄsH/{jfq^W[k0ˊmm ID+t~HDN)5&}. ݣh"ͧܭ }Wo 'EsT8Ӻ:H\ %֐WG{X,*ina`>7\I=, i{g捓^`{qTu1h h@4OT wU;3ӎ3*]ܞN5b"*`g 5C¯a`/v205ĂҼ՛mĻ^-O';BJ3+8LǤ}?ű@kOs'3^u%LJ#4tJdڎKuY{j$tlm% 4pvYUpr@t l[7dk0m-rTfn³~){}F'Guճ8G`i> 9b6V÷UԸ5VQzdwNA_yU!;ZZX,cA5G:a13Tn/G{P٭@eaPK4{VB!#w*KvZKA&Q!k+5^4k*'U":ښ[|< MKJ[k%7bDOe[Փ`#`ψZ/f~Eqknq2Yd!Xw7cDꜢ1A$&i#k~ )RgtR-0]ǚŎd(X$iIn]W>,C[?W{|@)7:7tu~ʴ|]Rg2xA*QwKՆKe0I&C$uM`=0"`$Iz`  褒IFƪG A|%EI$5" >~h$$TSW+v3⋿i#4PVk\WͲIk*nq>jEg O{2 =۞Z}(܉UgV( ~cg8?8+?\ݯsX f<УssR0- rO#mBjѴ"$:AޠΜ9݇[%NZ_#D\gǷu7j#[!{y$̢T[t;UͭčNcUØErD8hZԳO4Nj2$j;@4U#e`?؊Y܏}%;$59V1Ti?"AY*c}ę:ʱF9yr6GP/ q-sϞVDomM.'mmI6Ėc*aP >+FfǸHIս7hN&>F]t(ka DyA|Gf;"5D: eM!G267GHpgZK(:ٱBmx|\m3*vd84L̋o6UoaP p#!`ok)`XK{ Q3dkn/hh~TRBt꩗7sQ&6V\UD5=ʃ*a40+V+$5}Fb6sF5 O)N "EZW*ca:'! 3sɀ>I҃]\sZo`$!@ϐ'N#dD<ʦAIJWP8A2'vny~yW>{"Lp(e]Q} A`OS?{DAR5Mklq!q1ȱmbM¶'h!4ZN KiwQZdjhЭvOtQFZjjb9U%Lـ+ڈw#SoZ3^a8̍t uT|{%.TQCK} DSK]~G><v"@ ,>C#]xb~ R@uw@=LUcu^yV]ⶱNJ*`HJB;0uyݧ%P&OP;Q1kPrbrT\ur|QtXD L%# GD@R{95JZlq^q 3#L[>\ƒ]c 5:E#n)P[xPp.)k! LN m4RZ@0cmF'dA$'h ה@"&Ѣd~Ul7P"ɨܧxp֙ HY$l L@@uso!ߔLUj{ݡ졳rAc\25N(t!S{a{)> `II8GͷվyAg#ÄϳBk2>7ۺq& 40Op|JoLHDWu&;w]k`{j9yKt۲gC*W=(M=VK :.?q@{jԭ5RCLDSţ o7T,jDN#vAұkVcCì68 0;y#F͎Ng5d7 ߹c$Ԩ[Zt_oͶh X❂ƪ^ѫO:@=}.|E;[qLyu*hṮiݤ~Eo&hTN 7UzoGZys&OeUlls~Ӱ[DJs)iq̩/Y}AAwy(!'qUe:ݧq_Il=_:"T3kSκ#EgS+)DL+>kdSƴƼ&HU[qs!+akʡʩL{ g⚬G{AdZT w=e."x(A%| ss4wfȟ+UN$G ePCR0Ac<Ua*Dl~+$-@NY(ڹC$']}wsuYK(wj5 >OmbHGqE 2aNP|h'&6[v|UpW2DI9I_CnZ|5OQ#\K>I5)IR|m0~!>ǒٯhTV9[]H~?HTRN:UdyȺ߫.5m 2M #$tJRtJd)t$92'<{:aPH RK%2y:A6SԤ%>I$I$IJN:pDyI(IKg:iO)N%.0)M /)ddХ JyQD(ILQ(8 )tҔ(I:I])LhJPJS$$"LbxI/)&I2IIK)&N])%2M$ !J]$ɊE&)IKS  yQNILu8RKhI:E%*RI$)$2IBE:hIK)L' )tJt>$W\ze_5r ?kbSw#cw#~ʴ|]RaUʴ|]Rlj#ca>:e 4!(J mz'TT:d+NTYI3½x!fͮ>;t:PjZ4D]캔I"X=F@E1QHQEhLifTh\t(Lꂇ:" _ [*RGBM0U;mvj]&5Y:tXR@*gETTI$lveNRIX}cE+OVg ֲRRLt'CjI$B+P#RBI$C( $I'I)$H')tIE82NJRI$RQ))I$dI)$IH( I+X}L~U.X7r$М.Bs-+)L<O)$&qC*D$J)'JmJI$$:&HI$)RI$t RI$)I2JRI$(H $IԔS$I'I$I$I%)$NRJRI$"2JRI$JRI$H$II$I8NI%I$n TI@R$II:dIDSPI(8)I$T%I$d$I$I*RI$IRI$uO))I$tҝD$I:*I$NdRI$'LI&LR)TIAI(N*RI$:&I RN)RI$ IH)4ҥ&NDTʅE$I"tIH"DI A$I'I$䔤'LI$$JA:`%)2tɒI$I$铤$JC$I&N: RI$I$I$$R'Lg**L%)3DH" $ddI$ R$I'I%)2I$I:JRI$I I$NI$I$$I'L)$I$IK$I'L)RI$tI I$L2JRI$I$2t'LI$I$$II$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$$I$$I$I$$I$I)I$I$JRI$I$I,to<{WmNwd҄2%?KDI $FƗ@%)$C r߀YhZw dR/䣪7oXO*.nv;;v6G / JgDڤ>!;yPGpipPR:Ed#M0Z JzxpF<5 4tDi1rM"wO#!Ws(WQAuN5U1'[ĹgP\'C3䡍S2 x]WO!_|1 'fUd1f *54T?! 8h5g -qУmf?M sept#׎KG>*ˏlA:hH<"Um:)l3BOܖ.:&iqգPg[.SDQQj4@1T uZ)%|odXi>$~.KdZ8H5L˝R5B,ьJ(/'4Cn8s/ʜ+uUIO>3GeL]'ke>Պ`9([;D e|?ZipIGVD!Zc@׎~iJ@u%cknrzm/]O!@أ7=߲56DžN_c`pjm㯂+HIA HǶ]mjJ!-: 􌩶 t0mN4gK\ʝu%. a&4W/!T7=$5F;ks;,%/`ӯU Zm#A#k?4ņ'Q L >dc4IÅ:k4 4u} }j/-;s䃑w:K@G_Tp! +nR@#_Tl s4Ts5l'`D![vhu+Wv9^{q:?O5Mאl")4Ck` $Y/t몭'n;,pɌhCy.NdzqA;`:ʐtsqUdzkJ=Ս@I SO⫋5+,/>)tk$Pͭ)F+F#9gcЈ[iecnm{296V %=֋P5g⏎#3 xFkK ^R&uNkD|9I^F+Ds Vn᪥Itzp!}tMlG  [/$ՐeС[jTC'dRg衑(L(ӽG ,vhcRن0&KZ :-2>^k~+yA+U[ Hqdu{=K$q:*Mn"niԧ`]q9&|ĄzH4NHL4X XI=mT.qUCn3TJ܊ShK2H_igR5˪g*AE&J%M)CAmH-+R&00zlfa:?ʴ{WwBS:ӂUh>jN 3ثHӈ)pOl-*ZMnBj!guhr+w5S\sP}[_VȻWSO’)}@ oj $s1R)*1i)"*7#.cĂ!KqAB*!ĩC tҙrG2/ԩLh&OI)tJt'Ld$%.)M))(AKR7*P%.RhRS4JAQO mILҐtI<% )J2ɸRI(D ))섶Jd-wQL ;%3IF~ޫGu7x$i(zuM7(BP{$`4$3cFnC O*MnR% j߼K o2TG:L!i[L(9G Dm-.z9i)/e0dDiO`ٴVNF(^nrnQLUJ\XdfjL@V1K/UӤ)JvJ =z6x$SqFj;l꼅&Nn.Ы*EQ-IIKp(O(u\I BZA e-.&.;\e@A:T'I$chyN!$XY:djLa+'I%' #QRI$ShI)(5I@NS$$J@L$IA:iIJI$9NTI$ɓI$IJI$~UJUK**EEܩ&)5I$'̤JB&ҸI$\[ D:'I (g5 &I$SSJ$Iɔd)I$ILA I$NjRI$SNI' $ RI$)RI%0S JI$NI&I:dI)N)IJI$I1rD$IS$$II2HRI$A I)pȥI$R p I$.)RI$$I)I$ddIL'L$I$dI9QR)RI$$JiIJI$hTIJTJyI)$M)8HI$rTw' $IIE:JRI$I$RI$$IJI$HҘIH a TFJI$8Q MMJI% j$>PTTI*$+I$%\ZIJI$rVI$I$RR'LI$$JA:`%)2tɒI$I:I$JCdI$铠$I$I)I$I'EJL2EI%I!I9$DLtL2JRI$)( :d&NI:dI%)$Q)$J]$I:dRI$$JRI$t$$II$TI$tRI$I$I$$I$:I)I'I2I$$I$I)I$dI%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:I$I$I)I$I$JRI$I$I$I$$HLiy@BU;Phd§ ))d!pU%FJ Rd+=2NJxk 9iYq[$ R:~ j'USAR$P9ʱƝꏰ$ uRDhzG$qo5 sG;(I<'|!3 @R_fPJϭ+2', --jixh@(aq9BT.@EEH.#:Mo-r+FGD4͑:;1HカYHh9DOeCˆq~Q -ns6=@B춵LlBhP[U{#QN$hk>v@6hRʐ7vWdPtL[/ ĸ ѥ ~6m&5OiM!ˋ]#9L #CD>d4`R#isthn?Bre'$9N>؈xRnNs=S÷5uYZ#W\C # &^ԴN]s-1XwXh-qG o[p9׏'4AH05t ցԞ/"bsInu8hH GDRH7iswL{3!9Q;L TEy҈hps>8nxC4P?B7WȏN]Tc):'KH!y)6ʛĥe=ѼNø*ZӣO<h?2Cx|E-f6g e'enG+ )4ǔޔ6`|4:'8Os>w6HGMC*4$ݻP`:Qͧew[ q1~?= {3ǐ$r}&#kYhO,\i-ܝTo@T~J$ U{<+Ȕ ^;Uo24hHVkUlq [:+htki5O0=FP[8x HC!ou@jdN괝HmS:i{:{*Xmaa]clDN5?I t]e!˜:ffF! Z9m1Ŏ (fṿtNQlz<h@-Zu@$=Ķ4pp2%*6'eE?*+i=fOZška"KSsrZkpȻ&U%JF7 J4El< N\(6hVv %w04 Rpfb4z[Ge#!GZΑZ<V7߻$ǀ Z4 dճHIJt̩cl|Sqx'!iS75W;*1n><*.@W].&7L5Ƥ0ڎFAKAI%S[c_d Pz( 1/V4$/wAq8%>)6X6NN몐|pViQ}$x(( rCRnp\4VѠ .kwPR8/tMܶ<& ga7ُOsK)hexb 1Lq_hH])h$3Y`eC< ^KE)oiNBR!O?2.R hYԆ#@%7LTE #JDrmq1˴X$yH"%3CJ¬eeDR(N)g^h>lL9vqH:pđ7:'7YjwN˼U=uh @h(_hT ȱSs#)bH H<Xܗ!jhRī S nX-pǂښ^R C(hZ6oqHnS%FϢRQRI$$I9b$pP#9IJI$S$9I+$IrI9%,2t$HRI$)($&I$RI$NI) RI$NI$I$$I' T$TؠTؒ9M2t)bI&)IKI’RIJL2I$:d$%)$PI$R$I$JRI$$EJI$N: RI$I$I$N:*RI$I$:I&N)$I$I*N$'LI$L$I2I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$t$$II$I$I%)$I$IJI$LS))IGϊ wq&(N'MbRI$IJRI$p> rh Uʲ8SmH'NU)$$ڧQRLS2ӺP| mt&hB(H*w> rZAZu=*ӰX΅sXsu:WKj.yV'EZ'O5u< JvEa`q(N2u6H2r=\5<ܕh,KZC PRPdBv#ݵp۫IDξ SQ:v :yIlPu)n4Y֖h*,XrDe`Cu@]2A .]5@o$'" v6 =[5`χIBv|6*O|x#`)߼n#P$N֫N!{@FvE;g㱜Xȥo|RCuϊf % 0A>BJ5+Nǃ Dof<:3ny'O9+ZvRg_AIU^VA>vvzܬ=ye['F5Pt$?+ƩTgWH-h۔ / 8N<ҴCr-CHЍj5NWgkNҜTBBfPqs@Z {D|F"ݦ'T@[e'ݡz1U;N -?']\kGOoCdSgNMGIT5MhTA- FE %yQv+'qhJj`m-̆@XI~EPy y2\̀]i Y rEVtUaȝ|Od/;3Ze@k1HCE9 i`I~b8Sm<E UN -H /}t;xӒ;'c2`*nVE>+Pa7CYnq.3 Mէ!w\O+m@ ?ey"}ǂ~HWx߫'oT%ęsςhQX5CpOg}@xHCqƊN}EAgh׍Tws CF& Cytdj'#"j09a>=5{p|qj#EF_2q?IUVx*i*Z;R(.Xy#9 ۼ4V2PB3`t5l8C.p`Ѓ_kf5jʦͺnv*BT^}GbvX2ws›u ]ewA-:%E$[ F:F\ȪnU3q.wx< 8)i&#uKiIW gI4tIڕkn΁f]ܔkO$y*_,W_fנLC@h6VB  K T{~ IW!Dy:Fe6OZ<j 0SYn^ڽS1 0ATNJ%n)?mxrk3|F,#sѢ蟨?ΕO7yx'U5MzPgUũ%YLD:JR&!)JTv$2JTRQTRܢbmJe8t(u-I%j\9- :$ $SBiB}J_rm$mRޗڎ%FBtRjb)M mN-ɓ&$)yJS$l$I$LmJٟd=У)۪0أU/]*xHD ] Tai0oR! ʌ% )f;"]œTO`%;%1:!;#9l%Cq )gϊa" R tyu`S"{7hΪDO<4N OJZ$`OO<:I*SN8RkvI>!62PeHӲt?)jBt@MNJJA@ILKӄ$H'IKbc{JI)GMJM#$*TۓBe_5qM#=ؾ|%iVVW~ʴ|]ReV*wK?/,|2qXD@D)ۯ)ܶrRILp Sz,2EneWp[­pQL:) Ji Y(J$.LIhBu&"UYq0SAJjI hQ*L(,xcuEK&)XB ׅZQNvE8^]:t~TKSm[(vj&I:d;2Fp]U& RPL R(IjI%RNTRBI%0LҤI!92PRI$)I$bI)I$B"EJI$RI$I JI$z9WO!] %b9QCzyDzO:`IJ hSDj TI#*-qD)K'2ۢl"% R@ISMBI%)!%)$PN(RI$IӠ$I$))I$PJRRI$4)$I&*0I&O)'IJI$JRQ%%)$R*ԉ2ԔIOrr JHRI$SiH$Ir&򒔒I% I$$JmRS%I$A"gI*I$JgSrI' m24N EJI$"$I$II:JRI$I$TI&!0 IBI$I: RI$4)&IJI$("BI$I<$$II%)$NH$I$2I)I$II"$It8A*I$E I)BpNI$AHEEI$S')XI$QI"0;RJ$tE%)$Ld)$NB*RdLI)I$I'IJI$ $$I$tI$I%)$I8L)2t6(6$&r'LSI$$I% D)$&N$铤&N$I%)$Q)')R$I$tI$I)$I$IJI$I)dI$IJI$I)I$I$%)$I$IJI$&I$I$I%)$LI$$I$I)I$I$JRI$I&IJI$I)I$I$JRI$I$I$I$$I$I)I$t$I'I$RI$I$I$Qw%)!IVC**Oj$I&N%)$N'o)RI%&VF`3)V< xI Id.S )I&)p'IJ)$p%7 BҒPn6Zi# tIڨgY&M 4g4kZdA=TǰÕb!M@7kPӷRLY"=leS1P}fIh楸||2։죤 4=laj?( Fokb T*kߺf@Rk ݴ; 7Rk<~ @tZ ?u pD(ib[`<O6fO&6dFٱC~?R#BULs@wwQcùuQh05= Jl$83=4I;4q1{60Jz":5_SNmd`t-ak4Uha <\!2x5UpCȗ~ />t Nd2<Jɣs} 51҈@CW*{Z8]^io%eK[RH4vPpar>fߟVGGhY.37)P k\A/,ׂt/GfEvKL"gE[KD n+{K@,ulo5]~ivCH4Rʜ7Ls*`e#Gr;P7'h5WVjt;E Oii1:oa\r!۶(msˋmvD[1 ֔eqnhN`"a/d6b~ ]Ԡ6'E7UC-?8Ws\9-h>+jƳ=ޛG[u?!cq̝HT󲅴>D0T,m8R>hFS4pawVoM;\j2 B%-^r0V[|RbfW^y d~Wp#΄pTNPnk0deADAW2Z$,' WnʹGʆPf 9h0ʶs+1N.a! tnG+r\ U,AR$m1*-ԩƗ7nkˉs[ 5Uѳmm.Fl`hj. !#HNQv[KsW$RHa?#3YxBfֈn=6(t3lpϒ=Ty0n8 Nt;&>2ɝyV֙VhHܟvMǝc%U~wKN԰@7P{L[Bѩ~VNh]=/'̯\~CIn~Kqq.SX 4%6qZ~ g$k !(cG`Y Ѓ*6G*=͏| V[%5ck<Ԛ#J|{`YF~֩6Kqjb3%Uèjǯq k7G] [l~IzH?de f} j!sYp% +]BYP#UW!S<+HIDB:& QgeK<'觡$=.?$΃ॖbՄIfHIK J{L>|aFv)7Wu+st\3nr;>+ѫ 5~ qD2HU E yLI)hNtRI%)(I$$IJI$LI)I'I $O $I$I&I:dTN:I)t$I$I&N&IKI&I$IKLI'd Rg<AvCq'xrJ`C\!( )J4E8(I:I)yI2INJI)D %)$%):dLI2J^!$HRP$PJS'I$I2tI(IJL2I$J]2yI$HHI$$ $I"$S&ʿje?*ѫF[GMl_>_ gYU;䬯~ʴ|]RtYTZ>.zg?/<_|, -;5 Ѷ&'RРQ@')讼@ :J4>+S V NE5$Q5Ud> U1tL,Rb$U 44sˎJ)HVdFP,04nrtXM.:J;9FpAȥaFw_ыARpMmv@,!*uia*"KoeN:&|TR&dU&NS)ꝡ' :'I$DzeSg KHM1Ou%uRS %I1AjI%TI I$j*rI(9EM )I$p2tI1)'! RI$Ң"RI$I$PI% JI$jy Ti+$S')C J l!hN Z.^S)Cb!JJ(QxBF(nMBI@*%I!tI2bI(90R)BI$H$$I'I%)$LII&D)JJRI$:)I*I$qR RI$mRI$m\%(I)BjpRAJI$  $IR2yIJI$SnIJI$([R$D%@I)N6*RI$RMʒ RI$D%I;L)$I)) $I$I%I$EFTdI$I$N:dI$ʂ(RI$HJI"RJRI$'M RI$$EJI$NNRI$0RI*I$'$%)2I'  I(BOѥH蔔TI*ɂtXI$ڠI)L(0VI$L))I$d铤$I’JRd$I)I$Id)I$2qbI$IRI$I$I$铢&N%6(bJRb1DL&ELRI$'I%.I$)II:d)II$I$ܙ%.H$I$I'I$RI$I$I$$:dI$I:I$I$:dI$I%):dI$I$I%)$LI$$I$I)I$dI&N:JRI$I&IJI$:JRI$I$I$I$$I$tI2IIJI$I2tI$I%)$IEEJHrCw%2b$II'IJI$jd$IJ>!oV_L|B4@e\ I% $pD$)$RNcQw)P0`SvI()$JRIZݪJzGdŅPJ͌-|6Wq^IwUGgUmAU{XBIF{c]4(C\Y6D=ۜ*EQI쐪Rj!h.U[ Kq$ |?IG|GƇ%E#A cE muhoPUy򍫵(U{ѠI(W\O 88UCw"u5O*F֎XbXH\xvAЪ;iS?&t"VYl$G134)X㵤$*]|O 5À2|_X"Zu}[%`¤dI$K"X59k@{%vt*v%I;QX3}-4%Jwa!XӨ"?MvB09$4SH̲@G /u宵 qS*M[?": Ñ۷vK2I] s(^xϒ%졂 M7:]$~B16`UkR$drܒ0X~ Uat]oP@1A 5FC L{U0T!mRBб̥~03sdN.YnI._'Bs6A1>>֪Uֆ.?tu !iT#{7|*N P-{?il/um[xQPHyGz;J djݣT $>҇^J $;❈hGU.8huO谹h㸏oeq' z#UiĬ ҹ̣H&mn$}i>KBXoHQ$hGL}'xVhFQkĎ2K_~ v4:pkI6$vSnn D @TO)dGS9ςp0B@wGJR7ڥ!=^K Fg)âNR4>DDX6V׏w>a=[wFG1[Xu.Rlpks0ujql}-?p3YRk4ܽ4q*od R~J- bA~IFN Ыu*,lJEf| uZGĪֹ@nϗje+^B׎{.wT c)G8zgUclQhh׵ڎXlɡ:Qfc#եO} upC"5)1qTρEz5B5lPOaQOuecA;(h־{ :*[u0L~VdH 9L*Y-t!Z]?sCDU V; #k3YNj8)l7ot-w6uP2Lhx(H0DNwV*xb! R9 甙k] ʁv#Ǭ =#rF2fl NT11%fz{@ #\Ǻ'{U54rSo.><'89ิ0~oJ1թ=#VA8Τ.;Cq{AMLLsHh:7icCZ Rl0iխW i$hvBL,~9TpS&OtX/)Ti:cKVYQ NL\+^+)cX=BmNiP  x'O띨Ӻ@hڤnvN*痞Gu6bU,=K3_nגdV6엫"]«knV˷,mdԕ:0ĬG_5SX90XXy-hgJӈVB@h/`lu Vqjޣt5fO,ꚷ{#>W(t ~P:Nj["Le8>)B$H&#Jґ))N;I2Jb\fIItt&I%,JII,$IKIAJM)I$IJ %)Ғt)$LtRL)O)D$ $DД'JRxO(=cI2u&ʿjQ[ϗ~wZ_~ʴ|]RqU?_ԽY`Jf?/,_O}UD$DѺ v{& FLxS'MUSP{U\ *R:J|T +)J*Du`'"F۶ NʔRַO; FH(=F-:mw*69ER 㪅RB M=2t\{ZL><:T-ܐb ]Sj0~G0MН$ȳ9;*kL$F Ĩ`S" M5H+yGjtKuSJRI$2 I I$4)0I(AM )I$pSI'I(M %I$bT\ I%I)$IH(IUUʾ\L;k؆ * A:;L aMPK)$*'Ā%9H g)I=J BI%$6䔤I"4tI$I%)$NJRI$ĤBxLRRI$9I(IJI$QO$$I90 [8IJI$JI*RI$R $IN\$TI(II1AJI$&!8NRRI%ȩI$t0 `"$IBt1)%I$pƒe:JI$$R)$HTBHRI$0'AJI$p$$JII%)$I$RI$'A*I$$I)I$E@4TBI( +RI%)$H$RI$L'BI$IRI$%)$N$JY$N)I$b_JD$JH$Eb$SjT*RI$€RI+$I$I$铤$IԔBIRd$I)I$Id)I$qE81AJI$I$RI$$JRI$tRI2IdPITdR$I$$I% 0NI$I$RI$$JY$LS')R$I$I)$Nd)I$I$*RI$tR'I$I,I$I$$I$I)I$I$JRt$I)I$I$JRI$$IJI$I$)I$tIJI$$tI2I$$II$I$I%)$I$IJI$I$RI$I:JRI$$$$I%)$N g !tFo-pP*XUR>‚T\&. ' )E$)ON)I& AҐ Bd$,RI%:'U M$Kd>FBFOO2KA~BtXwG VE1FuqEvY]4QkLTq)^b44hZYJNV+`@+'!KOpVqi]eJ$-c*%d$t8ezѻÕiĀZFMcϯwXN6F"wD;S5Sm"ޙ#MU}3Ud?U4G$yԃ-۝߅QIkஶϵ>*p\;)y hns⫆>hٓ_tCOn(iW~iftwV+ckB#;flZ$Fg nQۢgO,7}"Si<( >6z*ۮej510J-& {5T~7QqtPX F q.8TmHo8<5F(j ͭH =@$4?rH}Ɓ9Rި+,˭4j胧*MH֫ / hVAyB Vր9+1ǹHhY;-G@7 NnE- >.+SbιԅaKV+n5(2P%EJ۵x+5'@$HHrTIYXZDxD`\<hj|;,+ 0ڝwSq;Ul,WpU:O&W=3dVUTt12C:KBiCݏpjxFk S2<I,[F@giyO{y:]!\UR$’=l93ʰʃFu<4ZЎjTeY Ì'ߒk_@iY=2:\ o/:p(-ov엓wܝ t U~+?UM4mrؕ4T+,5nOU@!qX_ q7i]FokË\{ X=CHxI칋q_h7UZeuKgkƠ._'8B}j#\>pב~]W]ZVP[:5+^̖#DNu5cԝ=Ѐ xJצ"gPqE&MxEʹ`*3|Mp+mJii$f~i*;BEqbcWȩotp !)P.pSXY8hi;&@`|PXah{tUCg^?G<>[F8<7ًJL`#PuW3+kƮevK-,D4j;(IĦQBʚK!7![k*da)wXBYMU$F~H# @Pox; N*NPwbրOt vZx=5֍AA4׺mC 'k Z1{3/&|u^ HV%_V#7zWf#I<Ǵy?3L;,vy-1u6ht?BqY6ntO"%IilΡC ]Gfu}1g6A;OL<|:͌l{U{K-.Ӳw7WTXU( oR#IZ⵺W~ESqkzQf|V>U`K?/n`q-Xi@VfCOV" @aB utO-Z2ci7bwp& ^q}e!'> A3EE8!a$v T-!.=)>ƅ.a>iUy庣x Μ:W vI~p>G2F trɊJ[H @P dF$BI]4e?`&L5ILL5NhO $$SHI)t":IRI$4$)Z1$S$&K)BIRRdД&&%/)JQ&sF$4pe- )J .:H=@uN !FμZ.0np%N'=FIQ&yQN])RFI0 )ƚD AxQIK`"S(IC3 TRNDr%.`CRI$>҂&dn=R( PUCIOwM쒓&C7'uo$(Ȇ9Kg`Cq^r˜)"J:S$R)t!10)tJ%… g$4E(JJDmM)F%0*e Ѝ]KM{SR3JU{3jBz T:e_5qz}&;+ыF{5| .|2}}DGh~ʔ|]RctUʴ|]RjP1c,?RIDRdBTaTۀ7$)H!$TϊBBBpH* sǖÑN<5KSBbq^ȧ] "l')Hj{ ̄{ (M& ʯb fT[mDU"weIHYDVݢR-qN I + .V@*,QM)ʊ+GNN%B#e'QKrUƪeS!LJJ Q)JSD|AW3,M6c;TZ!I1RLQRI%TʁI I$TT*RI$!#IJI$ D )I$IJI$^TI(N)$IH(IUWʼ\LTJSؠjPN'HN e-E"<)PRd nAKL ( !tI4()I(D%)MI$yIEI%)$I)I1))I$yID򒔒I$4IJI$!6ĥ2lT(I$BvlKp^Ǎ`)WEFB@(RI$IAI2L(RI$JA04I$d1r RI$0JRJRI$tI$Kj@"$IH'IJI$S覚$I' JԤIDHI  )I$IBxI%)$I$RI$d2JRI$$JI$I$I"CTIJI$BI1IJI$$IJI$$2JRI$I' )I$II%)$I8M IL' !H$I% & AJI$*6}T_J*RI$AJmS SI$JS'I+$2td)$H$NI' J!I2tɒI$I$NI);S$$I$: RI$$RI$ 'EJL$ $B(TCKd'LI$%:dI$I$铤I$LɒR$I$I)I$t'IJI$I$RI$I%)$NI$I$I$I$I%)$I$$'L:dIJI$I$RI$$JRI$dRI$铦IJI$I$RI$I$Nt$I$$JRI$I$I$I$$ILJRI$tRI$I$I$&yOJRA$$TC@{Q C&ʚIգpL/bSjI:J6*PޒNHױ'nݫ {y'E=JRʥZq!izNzO*".AMo]YK ejaf{$}BQq%JP?A#P(ܒP90M.0PƏٮ% gwWH\!>֍ B4mw5 sIIT}2xQ ey!VЇ$4Au o(lKW΅!=/,#yOtF@ƪ5tnex(4G]H Y?@h5VZM$GU"8Q.T^ZWnƣT̒9*[\\wjL/?R:OCsosV1sDg i+>NúѠ?ܙ-\|u(X7D+/ I_C?$7Z=3䇏,$+ K:MwXav%J̒`3^=3+1c@5i2!&VfAJwyTA(w?HXgؕ @2AΑZtp'Kn)*iZ$jѿU6i;o1/ipU@VTh8 a5(lG$&|B$AAqvy>(ޔ"yT]cN56=H:*skv2|CCCKǭ6R@vV5#U++Z\H j;TmI|R}ѩBr4AR-WoN0 q.c֘ 9..HU.q'gVd%=8huGD5k+ր5TCK\0:q #nqs AwM#u.F:G(K+t|28!s]ۭ3K\ലgk)&]ƒwI+0dowERp1YK"<V9l+:.>{B <RqԨ\R,UMZȀ As&V?hL-x52[BԷߗ"kO~U2|J#MmkGW;~dkzU05t+C!:eVFuWRZ'x >:.qvc(xj| V`xP ]t@C~ `(6~) &IkD7N hw&O#vu7_AU{\I ӺGfX颱[[By!nõ: Ž¸Yh?ZMk;Ft_y%5U}@fJa` F-%.==RI챬u*^kp4J{HwE fU!KýB(t)hxKS'ٷB>ܮf9v̏t4R{J{KX=,kv0r`:<J(wSxxCf.l2oW^Qd c ɤpFKt۪isAD jxI:iJ-!!q6 PX}lPKEOU@P2_uQ-:%kCIJ!zHenTH?GzAӉZjKX>69QUϠ7t1SըF?*%$@J!:*5fCr3HhÁ⚬_tѻ3thq6lk{+2>+5i?N>x.6|W!:.u 5:H:d`TbX\w\2!45qyvesIY]g<F,NF0s#/g~ƚpINks8ˉԕXJmjh|'V55HWDzoW>=3TlsCpkĎɇjX6㯵òFwf12Yj]kZʃ"eS'M۸JHeO{j՜no0V1Ze4X  1FCXx.֐ﶸS ,x-ONߐB"7UsX0%>Y qwftYa H"YGG'imO#*6].$*WQf')6p [ZjvI%Bvw 31|V4qYq_/C wo:-6ctWXloPKl!oYRm7NGDqRaJ KE5Xd`cm0FB Z*Ќp41D)U3cBchKEZV䐝 w;&qDž&tw)˛P%7-BP1ǚMeQ!ߥx(znuD!JZ%(Υq'E&d4q.L-8hF [qM 1vZuy {J90K 7bM>%I{{-̨|([{^v ৸HǪAI25/\V´ Y(ʓHO !- eZKɕ7jFu*mHD@|UVruTN*Ht"$J%@I( TI$w!TTI(I0S)I$A)H )I$I($2(RI$QR )I$#9W }(%blX Jt:+tR!ĈJɓS+SN:KEe k5o}HURb?'a8(М+7QrU!%~Bk55};qhƮn݋3?_TEe+ɫ8s؜zË J^kcc{3V>t:[$koֿYqVE=?_P?%T |Se#r& f]$\{NE ]*T*P+:;ӯDYRI$QSDY& H2B~@bI$Q)jh{h|oLɓ.tneyM.kYA-[#:ӑml-{>&%ؙU{NJpbzr9I8&W& ;<\X,Ro~RI$~H I~MBy\h<[?Պ|#^#IdawRI$nzU'H? S 0DٲB*I$O{Yԝ cp~Z]rq~.3 W5?؀#G?ɓ/^Թ2>xb< I$gf@=CV7v\1Oo?VhȰWKx/f:3<21eqܾ^c&L^k, $K #'V쫍&k68's?*8wf?cUZ㗠W$H)wN?gwʲk"bFC6,+n\jI$SlL\Y[pCDZZK\ M# I#;TI'<"۔U-/y%;!}VX~d{{EFqbg_$J)wo B H,j I$ҦcӲHunGiE/!E"3RI$ [ *YXW?c0A !axaq$c`deEn{ ?gdDx}R$JD M5Ẹug'l'kt%~t\\][h"7{l*LxFG硃 c}<$\@S =AXԝU\]`07 e1d#pRI$$L[q_AC$,ꤒI$r07#KbӰI "QyI$Ih{\UdLnYȘC,2!(I$ZWSR>=7e슜ƞj\KG1ˀOqI$I&)$V`9,(?z?_RC'rc_'*I$s:Ldm227bgBA}8nߦ}l?P1# uw->c<8OI$$E^]M.y%i~;oIWY3k$ጝ)$YI"dcٌ],x5T>m΂` {t_+_I :2sչA˾jwv;{؏ KlBF&pQF*I$kþ̭ƶޝ_BZi^C RZ`']cfH>_kة$TxSƷ%Z^JV^ky *c.$ezu IDŷ,tLDFlq~)$P Kp8Qw?H[XgňI;{I,}ckK\9B A!cPz$URI I$F( I'N$I:E$*Y$H'L%)$R J!I$2tɒI$I$铤$IڒMH$I$: RI$tRI$I)$NI2HY"H$rXdɓI$ I&N$I%)$I:I$I$QRrEK ӤI)dI$铤$I$I)I$I'IJI$I$R$I$JRI$I$TI$I$'L2I$I$:dI$I%)$I2IRI$$JRI$I$I$I$'L$I%)2tI$I$I%)$I$IJI$I$RI$I%)$N$RI$mङIJNS$ ,)6L$EE%)$I4)&IJI$67a:ψ[TVuV]U@H58RjpSR)"ZFcAcDm l6(8H[yQ`@m;l6}H;U\*m `Ǐܮ4OQ}6=% R6=n$h?Sk[VdngZ]`fpN2*H^cm{Zs$v6X"9Kq U61 r8)[{+OΩ:AY>F<[xkwwUۈs=K+cܨd ח܃,mw.WimmF LɝΝ<wV {b||@o/&<~Orai%Hc4D<x@!p#F9Va#Ot;wvUnCؠȘ';( G &H#wt>!eo=N{3#!6(hy$RHb`~幧wc %u="D~w@Zv&"2@>Hi))%D;_U)s.lg!w齃 m%H?S9t %S`R$ 3mwO Pv-jq'ͻCn=ߵ:I/y?(m ak䏽Xٮ_HNWus#۸rl%O#-s`$0<9sEVڭ` Oe1ǼiY}x̝$rG +Y:&FTߊg$~ty-: -QLR,ݵ6Q*VZw}cq5}⅟ԝHnJ^ݡNUcr( F4n&#W6Ƈ\u ?V~Қ-n:?J5sΜQBhyM>^i,i V\>Feuv7c++`XE8xt6tF5o;F*mp#T(.pǕX\t:(>$P2 |tVȧi5U݊IEDZ{!htޢ[=@'.S:׏hnjdjuniX5<# ܧ H2vf i;nCFѴQGυ'EsOulFЀ8NRCr0Өes;(cv܇SSb<Ĥ6_ٰ )$V{S |J]㖺#Ue cwj8HEY>rT2:^Kw@t̖9ZXv?C'%KS tš(6g<ڶِoM.ݜ4pP;MylI"?^ak2%W2IjݎjlYc5uH:CB/ƲX cvnojMy<|v Qu`𞛅O B 4ܸ?I{~ʓqsp p߇i܃ϊ$Aa GȪخS qaIH?cj<5rcS75@pq3Y)~NpwSIÇ{?y Vo-w_q!&hǷ}|!Z&~I najɧ]C 8iuUR ø eVo,z̕nUT7􃉂 {· msw(W`=^Jv]>3y>0>4jBNIR<U{ V(i>2Xzb!ДÓWhbRa^$("}%ՇZBWTPs)lSj-}Rw:qPoGv iD.*%Q S1B<5JJ"r;THQ$QqOd pvڥ%6⑐ %$꒙F.&4N@ M)LL )p;$ݭ JhJ E}-THxr6$ S_rt%'I%.\qI$BE$n)&IHV"TKa8NLC0=&hTvѤ'ҕxI:@&& ')$)H$%.5I$8HIJO)d&R(J$JRI$$*RRRI( BIR$0jqo ).LSХ(B+fRĢJ Z%; r#ʗ2*Hƥ@C~L)zILe%/M}/pRښTR*%1 jRS)IE$JpHI$Š1Mh$ȩ zwe_5q?Mƣ=ؾ||WJ~ʔ|]Rfn?TZ>.z%, '>aTLlY*!4lMFS4\Pj" \B L/\ I+H I4L=}DrR1vêK,/)҉Nׄ1@J ZĮnE1Ch^AF vCus@ꎶ 'UmP%hvSn;y)HB͆I(Piyݺ:.0괖DJbS ZĠ4nC`!0 !(SL6\QH9Ce(R).Uʵxj:F2Щj-RGLR IRI$T Q)!I$H`I)9 I& j A)$NtIJI$Jg)(%)$QL2(RI$QNJI$V+,+HRRQ)Y @qA:`MQX&RLBWCUR9t?RDf(T}q qd2Abu9rJzDe6I=o.砏}8;@JXdŭ0\9I$0V-X;T>OIdwVջ@4kG [ĻK4k古1e70^^ұM&n<'k/()>:0W?<~5$K7uLZ_ o꘵#-!o8eI6VnmE9?mSԯ=6Nh?ի#oGMFR0K,P94cqXԒI.o_9C8}?w?ˠ1sO]r9$e$nH1C?8=RʤIVHJgeI$7Mv~Ux~{]ïFR ~5)}Di4e-|Y;&̇~{o{̃9q$J<;tQ[IBWk0?bkVO_6? 9_gJI$&SD$Qܺ_vA."~?/\H ?ɸ_ R4%!F:9_ɗ-qe/rC I$-[n.k`[ZtzhmGp}-mr./q2')#< 3|?9̘ޟI$Tݠhl+ $gWoV,YJpҋ_~ZePxw򑀝Ϡަ>r|+PqN,|\?IrWUd8,kmǑ}^1VoIoQBF879 p8yO'ÓԒI*Wdξlx6U;Ѧ鷺=s/dې]XB뾥Ck~-*La'T~HK2I%=J֖:k{eW(c7д~!)JCޭŇAŎ|^x8 I$򓿨ȱhqm}vFEGr_[$K?QWNZʬs?͊r.܏Zt#W1_/>ȤIg}u?z^~wDx'b.Pɒ%SZL~{V~]8k,i@;o_鎱vsA.$kuk[<#ocq>zr<,rS/9}wIsW `ێ8cwב.0p}Y mn/)K %?X)I$t'MfRI$V'?N'?>b|UI.Ǥt>}4S*?[:vX1P5OXrJQOя93d<\|Ycp"IvYX:1ͱ_I:9d}L\''?-Y?S?:'gGyp^W4qG=I$Y_8=9q{OǛnݓ}dY<%Eo|.0BF㏻9<}8椒Iwo*vk & ?5s9_ZsuO't"wzǞ!Rŧ+^EsY7LMK8΢ xc?KLK!,xqccyI+wsbJLv%Y #Q$}w*<ğVGsKeSqI$NS(5I$F$$II$I:E$(Y$NI$RE*L2dI%)$I:dRI% MI%)$L2tI$铤$I' $I&N$,2H:`)ɒ $I$L Y$NI$$IL%,I&**NQIKt$ Y$I:dRI$$JRI$tRI$I$I$I$I$I$$I$I)I'LI$$I&N%)$I$IJI$L$I$$II$RI$I%)$I$IK$I'L%)$I$IJI$I$RI$I:JRI$$IJI$I$RI$I$IVELTB{~(N'NS')RI$L%)$Fu?on V ˸*p(QL2pӦ$QB1:GD%H)\&%7)()RLV;JSC߸UT;0BѮ\kh nsV~B"@d\OGVuK F䪮KA&͡r^=k ~0p-$q 2AۉU׍A=Fҗ;O$KdPcOV1E7 ?o<[7{*5XjaYim`p;Azx>o?EƈJȧJ%Z9\so` !})` `ڟ]%7<)ݓq…Z'~ hσ"Oe:y#LSz8N`]inFaonHTHxyipCAS6.)}>2 7sؠû:!~Ay SZ>2GGPtB3: JEtc$0pE}!:#E۩P?Tΐ4Dmaq5EuRf6pd{L;I![{C#oAitL4Up,$8(Ema1J?t蒭!F֍[4E"hgUgcZG_^[RAA ?g7))> X !YkD}6fzn0LHB sKKd?c۩W;+{\G_뮓Ĭ/:c6% u`ݎ}L,s]L>s4}=DdKNO(<$QR!&I+7Wk |SŠrb%R Ӏ*.`)y17VW[tϬHo<{q,fVR]HjΟ28e4i"jwW-WT[hP<ʰaYn  Uq6X="uѯf`f I9 ʽWϧ,:X;ӷ!cC`+D jPJaXjnLD-dO#0=lL? "Ahӎvv JEs5  -v%tO??]e`Ϣ\\2!K&{)Sb'+@Q@wWjeU_: 3OQGTl ;bMm !⿇CSӦʅX!+YomaCur&.+%RKBj\;$m!U[K}XN@^ib}ܢkdNnD&8dj=l]4hcHO~UC=Զ֑v>(e#1W}%* \`T2iGT-2U~4H+.^@.qJǨrg;X+&@CBߤѾ:٤$hMvǔP@ZXiGy 5eHp^?0V˪7;N;VէO0rZ= x!GnZ8OSW6Ik4SAo'1T݌K;O+Lf*vΦZ}67Ȓ`w :#E@Lj#ToG*V;hU#ux;=gNH&~.qʋMG!j@luU0ן\g:;Z` pk)iW6{6~7x4YGV(se q(6(z{}z}!V:$5s^Κj[Oc{[3=;iZ&> ͯf>ʹS4 47|:r~Awz? T2hh5iս=ps喹Lb:wZMt+9[NpxSunVUQnarNm5!ЂFG0K=ţ VAUl^DŽƮߥPtemu-kt{2w5Do;2xG8Nskyl*6Va=8nf<%S=6@,ѝs$χ';Afo᠟/VqzmPp͹&tPQ0o, [h`d['et#|ѐqDsZu?l[ &Jkw l!"Sä))EGVݧiQۭUFUL%*HOOFt ";,)`19EܧwQy=܊pT)ֿ&;}> 8mrVqՇY4~w,Z7G"M:I$uI:P DBRJZa.SdID'w))hTnP9J#TI<`" 0Jdʉ@ϒH``Ȕ|9IKMHJiOL )xI$I$LI$J]$$SI)t)M)&)$JRI)EK(JҔ4&I$%.I$$RRtO )Rd$tIKIJK! ; )E)LkIN vB bt aL! ~O*D$I%#h-NI I%,RNR"2JT'I$"$xNPJPI9 &)LxEKI&$W\je_5qa//_A%iU~ʴ|]R`7]_Խ\Dz_ Xe0(BO1:+u?KO % MqDIŒX1J19>lO$1I%.ˢ\j Wh3=Dӆ[)gG[Qԗ;OXdK#oFlyrK&?k8Is~7uMZ_?f>]6aqk\9h}n8G4]n&##m䄏?`K`?RI$ؙfǭ/q'ՍոC[W3rRvXC$"P$g.O9&L\׷8dwxyI vߚ.9t_X_D-.:w'o?l[vM0\|K% b kA|\cˏ|߫RI$2p~]XO @!9|RI$?c}^ ܟ\r龽2ϣKuw2}\#lcdK6I1 mPJI$v^o`w?kv.>I~c׎zwSn~tܱO/ |R(No1c.Vr2xǂ| I$(O]*`ɯ}Ml?U/v^|﬘+taw6k?m xc:|M~cc8yly/ `I$1ʹX]Wụ8q Ʈ5u]b_3ݷ͟d(O9,t#gpԒI.Y˱poj?s~sivۧYYWԃ1qYW{7'F>dI(= q,!,ysCُAI$.m~b3AnEC?z/Gvtשn~ObrGYkIg[ D%L%.SiC&L<8G }o&߂I% OTAʷXԱkU:OӃ̟{+PeUnEuo vo%*>\|FypOr%pqpejI$lVclno=Ev/I}cO}{ne&88|WV}M$Џ{7:oTYr'@G%RI$e龎!]+rmYä^!/o|L %C3ɄcxrcsڗȤIcBWU덆K;-GQ.`:vQCu,,7t ?G=Dcf&=/|Y(dˋۆ 8$Kʴ>N"׳60<|?W>ӟnvLAx !::qI$A]oԏ~.c>-rEhꁹ!v_N{SI,дzcFUouv=m.^)G eyS^^\<߇qI$:' [??*U_X*hDӐGb.~CݓsucI~f%z<5<cb~|?7$E?QW~V%ҿ;wYY:}a7K_kVŧ݆.õN3#zܰǗG#{qƾ^$\GO+}'Y[^t#~T#1#u29l>)$BwVzLW)ŀd ;VZlwۯWk?=nv78@'_߶lR @J̣ї?X}XǛ1ŏxI%u,?dٌaYN{e\I>eA@j$ GzjI$N$$]' ]/n \Sg ƺ7X珗ᘔ%ep~I%f Vj#PȮ_`gv3^v?WIG1ҏ"bcxd$Ø2ˏ.RI$}M1;XGR}R~̾]U]~SO[,jx,FB\^]rL'L>Ľ8:KK?^ϫNFG}ʖwNWRmkh kۘ8lqqzVc1ǀa.<qdIk W*#Pʭށiǩ9ݎם|/. IoFQDLLt yeǗYG&iœ?ze$K7 f};onY%t=wct69m^N tRs_he=6\Jh,=1 .cȅrKRX"μ\|=,cw?iV?5 :{!|x+5: @Ϸ1eal# 2UYwO+ r_ iW`)nT$޷9Ts$m;׵Ձ/-xylk@^TfJLJ?ڱR> ު ˢʄ[OWæi4]732@e>^}?e`d:lq(X85I4>yww򿐵uXlK@eYɻҀNdg5CzB~jCcpgz[HjOeVJdđ?DVf50em/vdqj4F\,H?J>(Cvǚ.ny\1FV֏+A,{^Acu Z}3JZ!K*wAVv37r{RQqmgiSc?"OVyOih2ARfm%Ѯ:yn^IoE,G#5SSp۸P[]]*McE3X!O'eNfc_P0[7"t59{4~̹ƻh9l,>\ |Ư%M Ey{#I:Wj]pkl!Tu"$naWAL5We2Akhc{*#yN;۲7o$j'$^7 dsnUb7K ]֖]@c YXi+O9B{K]*KpuD|Om-qէF cp㲳ƛhcN0uE*K-O~ᮇ:>*mh:he4jA}$X%^8؏Bs">(6 +yaDH3㕊dk\5j92:8p $wjOxVKhP]&f[L kP\WfUS~ϒ^Z=I}$]6aiG*}Uh-0t!>l?4a4'L`<,^ >PTг;>8~cyO~M1D?ugWl=ܪ  c&lx¯HaA < RsCY]+2ó!mwb0Y S,\ '[a z ׺x6pŚHw+Ӿۊv{=9SR<3%yp(A(sF7էGf1 />{sW*^&xXMxp)Vgd%X%m䕦 ˋgEog~ =[P+8ޣuRM8AVj"֐ N|Ij:ʃ~+-Nr.CCJ `I?5y%`I܂S,M@J|+)|.Wmu_?qp,>;BGh午}|AoVy* GUۯBDhTI4'L2tN:e&>IuDa`"d)ca;LjSAXOFGh (ÐE.D!xL⢐">JIܘI$I)I'LI$I$P RtI$IJL2I$JRII2p%2*RI$H)I$$I$$I ))A$&KI)t)JI$I$I:dI$IJL()"TO(aIܒue"؝ĸIPT%,ƆNcRJhNtLHA:RJR$I)M)$)D$( $I$$JIRJa"RR'/HgI2u&ʿjStk0;䭪<;/~ʴ|]RuR*?/W` 1tO|!I2cXxƹ5U H&³MqMkȂ“.Gt(AUƼ5J`sWTHGJ]EBRp!'h4QktDZE NDjL꧵8,ݑH2ւXvHId)4S@Ԁg@BQLZ4dL' QtRl2Ymb,$Jr uB~ASaKtrv&Gߚ ADpg(*A9*<%I';tM)$)E*ec+O26$$$'I%2LI+,#n,&ST[ʜI*  SDL[Dڡ1 :/q-B.Gr^!_#qK[hBc1䬰ie KC_&I瘟^Dx 6 : *2eI13tmAPƢ!ﺲ|+^}Yi~ vB0n*}(YdHZ{)}p*EA1N״ķdR߇T[c]8ԧky =:S}67<109#g鼆L;_YENO#C["k'_Ck7уg=Z`C;6tc&V:{.`8msq~C洲9G OϽw`FrցeL@6Gu}1X+Pp[7Ot ǴX ѓۋga5 CSqCr>)<4Q$w瀘NI7YR4sRh NE*.w'f(:-`ʈyb_#M_ͱk|JX6\Ը FO_vq+QUqnY:l%i|Vv9]i-J3aG.R1C[a<pEGbF7y\[Shp(IH0: tHlӺg`!;eZ^Ktv?cn#h`5+yFI?O?Ϲ湜z '9sc*4bx|~wE̯ π]֊ ,5@6ݳjZ'Y?c_p (84ͥ#QkU<4sIU__g>{;yӲ7!CeGl۽Mǭ~U''gjCFvѰ67dL68Q7i`j1Ս廿viலƳP5GP38l1Z21My1Xr%" ,`cZeJNcTߤqW̨ex ewsZO`\~cֵākdy%FB+Ž=CUK:?`¹SϏt׾b'[T}_4XXm%>k,η6XПpa??ธ;^}{닣Ƃ%Aξ R][cawou>jBpυuAл 0rgBhJӰ#˯sL'핟22{kp\D앨wsYpTqӷmu_O'[#B$ #vt)7AۢƪsDQń@S_s!ÄhsK#R ;-B?x)vq|w2@bH@.(bm-w`"6\ATqmr DBTmsaO(V8U.+.`]U2m<׀ȎVYGr2Y,-vgwZT,\$,:3eGbO k5=m<YMY[xw#Ee^ŅOtDԁHO+kX[p\fX~Z !Ήm6#9 OpXb#[<3Tw,Qj X/ J9T B-TCv#Q$Bz,v\ߢH#.qkvz?'V8U)yaA•kO0 T Z*aC =st2! hO5n*G$tO`AI nSSA@*ϤHU.71*]D~\8esUhp=V=GڭB:Nc+5#Rj#^H!>Ң'I% Sx$()|)P(`(e%->*c'^ SS;y )tl,x:n9Q%&ܒI`'--ФL^,k$ԡ+Td $iI2xJR$II4)(IJ)'ĦIOd QRR Y.L|S$Pd"J_T)옔)[e"ԔBp13^($H&(#DBxI%.d$R&I2P%j^RJSB+k-PoVcD 06#40]A}%*,ܤRݦ|ѻ!Pc`)X*%.ͩS!EoRN4JTig=Q[X*mcBIJp0组/OnQE{KgAI$<4) |!4'K*H2E2P;ƍAK8pSzNvhnF1vpn'hw魋Pat0?;䭪=5^_~ʴ|]RbW*wK֋#ca> Tͤ45Mjrqp"R$F TpF=VmbTPܚ)_nm !ꁝDN˸jT*ϓ0ha@ihSJĤ!:Ր]/)BpZIDl!MŒ@\袑O)T_Hx@0RRkxD6ʘpNQ \SJGiKh ~ RT( *҉] SZ)գfb% S՘YòпJg7KeQ"2E$RI%Q $PrD*$)$QJR ЊI' ABaH IL$1r I)0)HRI$I"$IIM?EQjGIpRRQ*oLQbIPI0NTmjԒ\Ku3d ۧ!~o #ۏA%&i*'O796He?ek;սWYg:٭Yn-\Z)x\:~@ry {#?f?.In {{P pkr1q PۣkO3drǒ?1I(̤)ڒI%(5RRI$ RI$&$+RI$xLI')ښT RI$;&' BJRI$tOOuSwllJhmf'*ğH`gɛ^9)$LL( e$I FkQ(RI$Rf(vDƛMş!6ŰTxjs9oƵ RRI$nl 0г>?/7ύ}Z$ac=1Kہ?}`2cq?W/RI$RNUwI)(JRI$:d%I$I:f74 qpo.(pxq5s UݧBUƸzM=[qp5Tůg#Y(V~Ӣ^Q7T[`ڞrI[ZC6A 3x2^ٺuIZ6«Sjq MJ3Bv[/;G UndOo:yF|RaIٸwUIϊ#u~)cH2k4"y;j ;OpYۮPfNHj";"{Wu_ܭDG0ckoAO&yUv0Q"gz⭒Šsh iG{DMڃJ v^ 8ʰ᷀d+kyCЕkG@f#KG{<{a`{!%'I-ryK]qiph .}q3HVs%]y@ yӺcxi,ֺ֐ZOMh.ʦqsE79mk!D7@!9BpD uUr˛ skC WDNA>~gb[C OʹV$?U \%9u?Wd9V:x0> +AXTzp5^vXGՋ|^ՌKgZqߣk|_]`<@& k'-fC Xp&w8T#eORR΀>$vxGq{knJ'ޥ͟GՎF4j}[ѱm4yq~/q'r~SZ{:*u@<N*Rf͔RKSx'͆CNVjj{Z>Ng0i@ i:ִ"==E0nQGwA.!v?M />Q5# nzk :GOm-%l O$ӔXwo5{9yH [E}A * 14=9cgY UwI:Ls$˭FưA`JVĕPg31j\cikGe4)dciE'SVegThnᯇIQ8ѯlfKd 'impؑREVQiw^}SA-=J'.7BXs$kXWFZz#quW0Z IG!a]~ yc mh䴬V ñWQ'gz޶%=Xlð)}Yܪ uM;[74((ҭ~EMĂ!e +%On%VVM Ɓ Ub p=h²yFn3nqx :6ʂw2$;ѡ6J 9iHULR)l6j!f]-b%@8V}9R\:OB܀1@XHVR4_}:dZ1젣,RWzɽrj97fdD₟죲jaQ5UXH^R\їs4&AfӴGmU߲1iX?u;Xg?i)JJj){c:~:+G&TyV}u?%N0oi;5 .)z Viʰ3`qC8=\;;gU=dޱ(ڵr&A!H!8gVa.((Z;:xc[%/LrV ô#E\<A V:d<)'Ra{k55dm~R$A6\#qQ6~Zwe4W6gD_^5JիI$&'0U%ki5R'|jMHoNl9 K-8q<%j,JxwZAH':O: J6/eVXk۬U`vNI(2Pe;]!`Wtrg2V qUC]BۈDIFի[HtVX&VA8 GrW9 ?hJvS$u#Lae* qJЮQchDn8UoUL\(AWHg;#!/Kh 6i;<^?mح1h'!;q*hwtrUY })3gq8b_`gI4+ѫ][=F-[ϗwαU.Ptwu~ʴ|]RJ*wKջ8~Q1~UBA)X۴*LpvL4ʢꠙ#x \\ #];K^cL j%"-H&TMe%W}^(eDD£[ ʎM";V$J7")8`B( JRd:VD 5aXpA}~k"DɃ!AlH[?]$vZa3MLvc#|J  tcRt_s9ā'wڹm`#P:. O)vie2c0UI'Vs~a&3\xR}"OgVԯRh唦"kG8yifyX{%$K;?ϥ[Ot[1a5p@c~:kQPhd2L^)< I$2qiVhc}M=7}?\z2,ϗ|MŴY>$H/G~oҒI%;6cGXu,aP,sοfzNh̫%ڵ}czsflۺa 10 ~|qI$lx]r᯻>uzN[Z5ii(7ekuOi${Py{$e6sLz69nT`&Hzq9I$>tQgUvcGZ9a8DmK[-v %`v~b0IDڽg_?3dg\<weI$}_\ogq絾s =K+;YUABd(^ON^2cHa75$KUP*cY!ӴS)EvoWwb?~by8J?>IMoa\W8}?z;"UK\3[X)WԹ6df"kngŏ1Xx'K$=RI$2s1ŧ䆵>:-A1R#uya&ÊI$\YI.omO.6 \I%}]XnA'cHmcL FlS?V.=:S8cOHY˗c& q!RI$ιq:~݄4b^OPeV9kl@ܙb)WԹ%_?Nqy\R}xg#$Kfܞ]ރ+7rbZf},ddz?ga9 xEF16^C ϋ%9RI$,m0HtmFuyX寮F}ҿ;g'.Z9C˘/s8Y8?IlQu2Ƈ6>^` 7S*XTgIIH^ue$H} >cAQʿ֚ a/KC?^d}nB8yI$/ _='cNC})lỷ7~F81ßeOm9%1 "18xL'r9bŏ&_kËI%:v'Q݄4bBqzm;dQtHwf( }AQɌKŃ4|^C֤I:IPI$L2 RI$Q)ʉ(I$I`)$N0NJI$$JRI$$RI$NI&I$RI$I$I:I$I'N' )IN:JRI$ R'L*EET2p$)V.I"5:`$$NI$$I2rI$N'E I$uJ'L2I $I$HI$S' *RI$I$I'I$RI$$EJI$ E$(R*-R(LLI I$I%dI:I$I$2t$TʊJPN'I$AJI$N$TI:I$I$I$$IL)2t$HI$I$JRI$I$I&I$R$II&I$RI$$JRI'I$IJI$I$RI$I$I$I%)$I$IJL$I$I$$IJI$I$RI$I$I$I%)$I3IJRg**LfɨHI$ZdI6q IJRI$};P GҠ52Q%4@'8 $1Hڦ:ODNZ y=I b I &,8M*mS)kN+ORayLm(P%R8FO(Ҡ%F% @F;%*L:drGi %@V$q{)L;!n:lVXx5R :w+,:&R-ؠ0CgCsI$rf!Bzd/~)-q'N!5K.p!>! &Q7~^@rU}r$.aE'TLɟ CA'"wUln'm`tvp1;=X45c.2=TFA!O}Q`qCݻqp;X*mC,7ީDv2>ILL!q{uwn;k+l 3(=kjj9O; 'kA=C9 2@!*qGx2>JTGp5RU+(-0`7G8B# ox Ԑ M;,R|\CKH:w&61혮'h?Orn~{.|Af9>hTdgޙ"_Kc넓7l{" 俨ef!ӡHdq^$q :"6v[G)(;Dz3y0ۑYbڧ~.LL ;GY#PGf#~EQM*]2njU&Ot9ѩfC&N`*,1:,.UY-pAY[A;Z9C; q@7IbuGCa׋X#5[.{/cOV `Bfs#nVwTf3S{E43– CvBNV,F;JLIn~+ qsC]s5A]rd+Nx,ԧGFݥIa.o=?EsAs"Dgķ4hφHJ5tZ`y Tqd|Pmh` ͍k|̖`]i 9Gؠu*-G󖿨cb=[)xwCd|c\%־iȕ]YaL歬w*Fաi[Yy<Cm{X I C4zĄ:i.hfN >U3nJ78! 5;31X~cJ ׸WZ9cъ];;>k".;B;kGhYVN@?iZhr-vOy⊈ѭK7H[M MJ$< d+.z{5G&?@BE|ۡ'D:ELw*A`$1 Љdt['P IGaPh QtM#I$uL5*S<&I MD"#DOc<4`nynuݽP^oh?Փ ;D W^ )!FAhG{Lx wKCP0L4BȨZֲXeS+*Z\l·챮 ΓXЂVS >S;E"zi)}&&R%5|'f%%?BQF"hRiGe_?QۣJhM='ɓKr!]Z紻_ihG#4v?KwLmcTm=B1qHI ;$+h3%)d=RR GiM z2 =>iBiKXSTpJDBh#JM$(OyBPS&-MJRr[a-l)IM e-Fh AI-S-6 5JM2%()}? )jhJtS--2I%tRO wH% ~7> k(",h6ِ@QJL8Kgp!7F a)LO $&Rr5o(gDSGi:$]w!-:%JB[c~/V>hMl!@S\ WDqMBP v[#NSxjbe(Ђ.pNG*$Д'KT)RS- Zh Jx# )vSBZ(*!m IJf]rpM Zȩ[!%)BI)DBPHkI2u&ʿjQ[ϗ`w[_~ʴ|]R{V/V^h=?/<_|A@hi`Pe $Be*0EB3nBAju#K .QBۻOf(W.#Q[9L nN"TL4NL&)V;n6]Q aLvHE4()peZ82A qqAF*YEЌWlTeM'u AL V4 pNہ2mw VХZ)q?InU" ?b|**&T9*璮ʦ#0FH)%pI(bI$ QE I$7UARI$TO*I(HHUJI$(D!1%)$CI$BI$ ' )I$U~&$)D&(PjJb )Irɓ m]GԂ[~\ʿк켑kx*lR%,2d g(Gp~Iڙ8*QA+_U9> g,ONX*n4z{8'z ?yr2@=XLeG'% /_84 6햑Or~o_?Zyn>7pGwOUoKہk2cՎPyLeN8N0^5'Lfw~U,+\:gZrp-a{QWC [7}a:8~X.&>c<^VX.,qQvqRI$ϭz,[?\3 vnElqtxJ객Gn3*6}c]zΡfWs0Ͷ.h?]]xvtK19'Va @Kp,\ 'Y2Nx椒IrXu EcS]0?P=3.$0wXԱe&ԒI'LE1Iv?[O.4o?1+o_(IuǮ^?U.d}F[,h_r̺ӧ dG`y\b%ɚ1f'$JDOs+__]R}7M\>߹bʕU.D$@)WԹV)_ruCNŧg_l}Z,k~#<\1Q c6_FpMI$:ʴ~-'@Vedݜe&VC49C&+!&?vW,_Ih~ZO\<>^'7ogA?7tzmeќe1 G/g3Ï!ϓ4=97If׏CKoz WN&.y~Gr!E"$ WC,FS0I%$IFRI$dbRRI$O)HRI$)(I$$TI'I$RI$NJRI$$I)I$dNI&I$RI$$JRI$8Q A%)2tԂpI)  Rd*.ǂ&N2HXI$ HI$I$ RI$rE)2t0NI' AD)$&N:dIJI$H$JRI$dI$I%)$NI$$II$TI:`2HY:dS<(1LĨ9D(%.:II$I$$IJI$N:JRdEA%('L2tI$I%)$NI$$I$I)I$tI%)2t$I)I$I$JRI$I$2t'LI$I$$II$I2I$2tI$I$I%)$I$IJI$I$RI$I$I$I%,I$I$$IL%)$I$IJI$I$RI$3??$u_7 )JLEI9L$RI$$IpI+]3+f?L%40^U~ )BpKv"Sb袞RBґN-By'D%))P $Ná>$KTB[Bm2q%yOh%4Br@O))D:M(Q8tiCi|uP4'B5E0QvxhS]V XiBa0Ig{D.xHIA^uhdi䙴hz)䦡uȣ> `CPcRi {:@ #Ĥp*$g1Ha$&c|ПxoѩUYdjߗ׉xPtR{w^Q\CY,@d͹keM3CIL'nC jWEah+e`Z0x vwNfShGTSVxCF@?Wa9CVb8lS@ lײ&vM6St? 6txJIp*As mHb=)G<9Gy oݴܖ\Ѥj@n{F(U~q tU3Ck[+ }62O+c +b QY{֏ҍ徣77DZ.nuAO ɆXAtgܟrޯdxCQ+ePG={mqlnGTkvo@ h]'9ILJ6d pOϴ դЀn1mOfÇ*_v!__ #=Ʈ^ûw,#?:*e 7B[BH?fϑObKqǙVnD8NcnOu֊@-1ho8ݮAŞR'k۪FJ&[^5k =Qvhb;edg}`di &bGuo:EB96Ϊ}ڜRF.)ޢݴ>Sc]v/^=CB=֯KƾѤ,vFk(U4ncU&PdE$mh1(.`ejXC=vTF@Vq Nֆ``s)dk$8u!seALl7tA>+C =,l[`Hjf)h#kBq >օm',xAVAIݮ^fuUr >jc'cBiA'p<nd$4xG`d7Ju*-`?"CK>*X6QqX@գ}.e΢mIg+YWcUgSO?pC"y sZ="`ѵ-JN 5)ZrNLB,52KX$C*M> hD)#E%LaInDi;{V$dp4Ii>V$i1vDzޮ}d}՜gk%BA"hBiNJb[,q>S *W9C|Xso!9NߤU4*I#]VV& |2Əp<ƴ0{JV  bP==[6XZ9Ua$O ݉)GQNSd ({b{BcPA)AE6[q&u:#׈Mn{IV)*@=S ԁJS%I!xNI1(I&N'I$I$L ]$ڤ4JRIJ:$$%(d4%)$LI$$ $Ip)$ &N)'&NI%/ SjH$IJ$8tQNF)Dm*IQZcxB %* 5ZS\>4&:h$IK%I(t$4I))I>$Hj2\&RIK &(H$StwJKl I)BJT5<(!IIJ&S%)NI$$)IJI$a7 BI)d'I)I$I u&ʿjgֿ䛿*ѫN[ϗ`~w[_~ʴ|]R|4}Rh6 3$@WK>aU(dBgEJ/&4Qc:2Qr*$j mQA`vsPqS{9I4*yudYMD,J#"3tY&V^6IZ% J`!$\#T6?~^ !Tv-* Ju{5$T;\JK⸺  e2YK@R@=JtDWŏqE`$6J25 ' vMK W[c;xaq()x{$ G|U=7:l%B,H-:;8RCH$N9Q)1I J%DI(*I)$Ld%I$I$JRI$c’cJRI$I"I$Id$$Rj¦oLQܠT $!:`L$RRDL2 & ʔкd$1}a- Y}{G$ vGW LS̨TI}caBae4(wZRI$0$2JRI$l^8xJI$E$I)Wk2aA$ETI"Y}{kBiPaoA[ d%u2tJtPLSR'LRI$RI$'L$)$J]$)17Ȏ )n iD>Ӣ\qUOi#Wsxq!c_'mJU,XFD"<5lf>uh}p ٧c҉T4>~*oht ] G c QΆSDI]p8@ -' V `7 p NFDi>cTL84aF9 )ofSۯ tL?HRU hh=IqFeۛf@yqcCTBIPubB u4>5QHl7w㲇ʃ1sp'kyI&[AxD薋 rҩCF䏥j.ulQ1A|K7Q v#yD$T4TDx (8x">iR QBA9.?$Q{N^kRnBs?0ef4 ȏg9|}h_Px5Nx ;S6Ot;};GSQe ?"w9o54`#[mtʬVn A>*w@@ťW07<:g%HJ"_eWc0ݽrIV2ZY:NWDzefCG^75+;#p4(v5#WcP֞K/Zso#?"TsGNc^MEvƪ. cYiqѡAiNj;1i{5v0f@:np-[6gb#cGä85 8]ngav0*f 14;i ۲=޵M*XeaD +A V Fȁ˴vB{I:$|\􋵝?b=ӄv vϒ#tN͍"Cg0kG!Yu4ªry5N NHkFAR1J7̣[C} N<)"V(c@R&오RJzT\쟆4t)5Xa}h-^{%5V;v*[V`w\\<2Ý?^ФjJdB[$.R D'I>jU(tRc=~ xj=ܮ|? ^&OϚce_y6ǀ*8nk'Mzw- Y?9Q&TP+1/qL$H)t'I$HI$R$&M R~IdI%.dI(K%)7 J'I%(:`I)I I$I$JI I$)I$I*NSpI% $dM)Ρ4'v)P-&b$i! H4*g vQ;&/)ΉR$M EJ4'H%I$I$AKI8LI!I$<&N$UdK.'I$zSC`M1JL$%:bI(S$$II$I2tJI$I:JRI$ctJRI$S')BI$JRI$oQ? ()1N!@rC铢0 Ir2tɈ+*R !8Aj<(HA2t!iR!E4I'LS)(I2dBI$$IRI$d$$INmyI I$kZ`*,U1B ZTIT.o)hFN4J%TMvP[P&t.dr@Rk RI$♩8)$RN $I(KzT$IʁHTe%)$N`E I$NIRI$$$J Sڞ)$PR @&(%I$(PI9I$)I$ *J8IJI$NTI(I$$I$H)I$tIJI$I: RI$$EJI$ I%)$LI$$I$I)I$bI$TII1M)IJI$9@4JIkQZPiR%)$RؠyN)V.I)%TI$I $I)$QR$I' !I$pBI*L2ILI$I$$JMLS1IJI$I$RI$NI'I2tTI:dB'Sb!Cb!D)T$I]$NI$I$NI$IR'L2tdI$RI$$*RI$I$I'I2tI$I$$I$I)I$I$JRI$$IKI&N%)$I$IJI$$I)I'I2tRI$I$I$I%)$I$IJI$I$RI$I$$2tI$$I'I$RI$I$I$ Q8 RRuQNCƪ*5 RL I$I$ $$JKw,~kiPao@"Q(>SVd$NRB$nTQ'IJLS)' :JT$RI/$I$I %)J*RiI(O{ÞCѺ|"H*)VUT!öɉV,tv:UB6,YQV-wF`sb:4V] %Ϲ Cvwpu5\LxjnU=K* lcUq}Q@-`S.%;7Ws@Ӯ*Y=5`Iuhm~ ]ޢt*t$5yßkv#Z^/w$FUc>$3CPr2P fUq#OCXy9H6[K}+IUKiH:`jS'ԗH \tiq˖\%Xdy^$VQT̼󜵬0p*p'sx-Jn(maOJ6a.a+4G vrxG3%2~(-D)4K>(,ѡw uK`,#Q:CJ> S@ʦ!#9Z^aW~猞L,<7y~߹=W+;mZţD(d~s33Bժe@ΡSɨXdP~ <{`mcq0?"Ei)y4 hfV ]NxcRXCDr{c!Վ75]C=Α&Ͷ0ϢOj[Ai<1VoKLm |Qx@\IxkF߄cm;l+ZC?4T6Wi={|UD=Bc7.?eOֳr&}r9+X{}A¯Xě=ՓwKFH#)oh ,ާM gs#S*&Pu|]u0kmB2P./`GxUid<ʧ}$:GE6%hk¨l2քSk1i{~j;_!`ӲYwi=Xc ݠ1 L7SbZ^ZI݊RHsY\ &%au Y`c>:em\Y}\ֺZFr?wܩeá .ԣKvH3M>۵T)ZlqZv=V`k 5Me`̓)V0;u4Ynrm3Pmo?壀C#Uk?KP{tזCڒ&'X+wQ |?. p>e08hξoWwK Ocr ="ܠv"Cpssn-P?)i*wIڍ!&|g.lPv<ΟK!ަ`H5Ka搄fW8;SZa+8$DNILI\Lt4h)8 %pNEkH- :V^^vMb͊6oCBf(e鮳ϟtmoĮI'0M*3`I<&R" (VNӵidv *%ӴxKwӪecS^T* YKdt1ki#UN ")vpi~iZx$:j`ӁBNL`$PIOty'LTcmpĨPK` S¤u`LvLwi++QhB7Ȭ"J#Ef' aAShH4wLZ^trIKyMIILpGd$AJNGr@JdOtЊQU)M&RS%)$%.:dPR )t-ÄP$)&RI$IJIJ )I$I 4H$I$%.d&I-())E6#$\;$Hw ZnF1vlnŧOa//_A;*]9۠ ~ʴ|OK֛LKUF?yfO}UBʃ\]w#M- ;dlD$;(Vڣ9R2!A.&uiϹd%r@uV#.-R`bPK=5b rSJL- On{B)2T@se+L[(S e:!8D)cuRstHMa4G@%0)N;8*EUamlS4((P.vQZ.(-B0Q!fZ7¯aptuapY5cD$(A !D Nbe|QqID6S$IJR* IJI$SBHRI$RJA*I$I$RI$$JRI$E$RI$9LI$&NRI%&XʫUdLUˆLRK铩$,S'LXB@ҖO)BpP! 2 nP(P(!tQ*%H(tIDNS$$I&N$)$I$dI"`Kw(%*8BIYZ0CyUf(#<`z,:e*ڝ{kd:)DJI(DA-JnHYS'=gmxx@uutH;tD_}ӱ'k8> "FݰcTXs;s)Ts>j%$4c*dNhǮ#Q,t}Q)Qs9(`nQBO)O`@%o1tq®/u =f9G~rj\JX6eX~DCcW7wbx{&{UV<K@E~ ;vB}?GVe~62wU{aX '?{wCt3⮹$C_nkVeӻ@gN״8VGKe̖?"p ˎƨ̭ѣT~P;s)v2` ZkZ#5dUa` vW]}H\ Q +nNiPj%d55~?Ms-p#c3B#O460na9ܘ=rݑa?P[Iʠ>tGӻ vME:kƏ =x^|\PГ ; yM4ڔ|JZ=ĹJ%F{(V<紦 Iǂ(J%(7Ge7><(L0+C8;-?I G:Y]Mwy߮:arO_ohq 77WŠVn fPeO5Q㖌Yo?R:óM6*^Eк՝' ZA/VF@G!]4ڈQ za BcN bP_)p>c;WqꈉyᴂB٩ƅ49 |YGpT ` -$ &d5t'!+vY:U߄ڇ 1yl{;$jixsカdS}"d 4!ꙙm &|F#D9uoi$n&a$b@ ;7-l!@P4i3*8hKQ[+nF>SmDތ-q>%Vd-Ӎam  |>r^tB {t([̡;1#h#3]7p\ W[:G*8.7Lmkt$\Ruz ђ $JX|Zc+fI6{#j}@`u{ZӬ<Spx*/'PP7wdԦCZ^<@Fi۰Tavʰ#RT/m: ]h04NVlL}4o0['FV<|{ XO)ASi 04-KXַC!&l|c -FTɝ<7I nU/ i= JqxC0 ! +a%cqxҺcMQ2v/%ty}AWKNN֭ZN=dOdQE$ R8Sw$Yc^Dn}=\)&;HTAhjwEyh/;3ӵxd ?"T3|~Z ձ Kmv#Q_A^mpwF߇m"$Oΰ=I0wLS}GWjt @]ci5/U*V`5+UXL7hFSԒןqV/$oBO Oqѣ ԮD65Pq }Afu?ak?wɩMmFW~ ǤcX*/sph}h$!&@Bɾ\NUrPS==cR9-v"cS_8RB߂Ol4&o;P fjґH;-SOSG<:FT򴱾f:4Yu=̡MYtuzj.xLhxV݃+C'HcWPj W+JqѢhq)oX7sۛ~'n]LHV}:d8UMZɻ)6٫Zo)zarx+U9*N>*|rUsQmNx׺puWHa &{JRZUΨ`Bm}ݐ7'ܒ<& ʷ6&$9aԕcg[~}{S\awToM7%3%%%(58 )8yHWHQUHq!(:= y'RKUm HqWK'X*֝H z?RCOxTOyqW *'+ ;_Xjsܔ A+CObB%-M/RAξ 8 ᱧH6S%/Pjn= "L-AH  (a*ҜPj0'E1u i!CG(;$J^VZ^򓭸w*$j*ke x* zV7]s(Nh`v e7c8 s9*/Lkx ÂBO&TlkiA/H+1xTDĭNQMd/Hx$ih<U=TުV59ܒi?~:zM.ϭ;wI2ħ_ϗϡhU>/~ʴ|]RTYTZ>'X:Bp?a̾(n rn :"d'(0pnXlmA7<r;mJ}Kl4i]Q0ylLk%9U},-J-v]e "‹P>  BpSJS ۹I2;5YRA 0ArY`N=RkKJp9x b29R}j\dZhh, @x&q̕74'EKx"IHAȢ,lxʚmN wRXSSeȬZ!Z$Т[2kt@PȄ:m D&bjĉ$$ $$$I'LI$:H)I$`JRI$t$$II$IRw)BI$H$$JAZUBI LS*@rxP)'D jL I9LSE,I7!NAK%ܠJ !tI1Q)bI$JIBI$ɓI I$M IJI$,*wBẒI%bJkdjUi kgIL Ma) ҒI%&LQkp#ZfI<% 䰘.k(ALVY+'N3sH"v$N$NBJRI$ ?4h>DҨJY ꤊ\ mk+meTCI%pUZHDBy;t+`$Tqy-:xVCA'_h(U5(?ZJB(sʼn*;T{` Q=bSz 5"R?Az-EOPD0 )!XR. ͥGyM mIL} `R9qNLQ& SgF !Q1ߕTv[`&Is鷹 D7;MP5OOkwLGƿ<CFL(bGކmI*ŢA G VXFJk#Eq GnSs>0J:HuE,a"PdC/HT٘k혞4ԩ?)hE gQj#%&~6oE 4Kw[.ׯs*T6vF}~AqYpNkk{>M 0 8Si5\u¦v !3Y#O]nt M541> s [?EXdWǚ^\ i>^+;O?s#My*{u; _mץ$W>G<iXcS(iQ٠ jԏFFH]fx|5TD?*ntW &YyA {}Vmnh9=aq`%<;/s3>+T+UjqΚӷqD(ĭpP6n Vm5eJ60yV lMmkGiOH`?"AU-grS~!{ʹ{<{$t'v"L'phcI$vx̩5kܣY4N8 J`534$,.wBgwǼ4oj Zt8Y=<\[csz,7X.AЍOug%A63Lr7)} >E5'f}b.R[j$!sTC \5jpې5+; 'R;v_^5佗濝uGY{> :?[Yi<~0thԫl'ZLx}Bu5xuܳ$D!(R^MXf OrNNNR[³P#HA?*OS w x_,  C`ƞ!Wt-XkY6 ( ʋg$zW2c ={֎xgqB=rp*:%[ʛuL|CKv0I}@`xRelP* l$pU5;Pn\~ +]N 8} ՄD?f5s>(,/tu壄]iOA͐ӹid6uFL1ak*}5 - p|oa_qoG-fי(USSB<S2E%x.Tѻ4`]~]՛-5*܍V;GeN\iet5[p`Ԡ[ FCw8V5$r-3h#]E6'Qɂ+|}t}.]cY-̮ I1 n87I!j3]askWba Us(oiA{=Ig8Uy#%&|"QP(LBkZ:4Y﵌7}CW <]́$25矻JV<f<ˮ{q.2|h@ArsY.; 㯓?= rmĦ[p5le!;u|@:1`?3`:A7]΃vto33{h8 :ݭe22^EbFCp4mAIA~Qv@\djQ}2J+(sU7 nP>Q9;y:f5AouM"yFU."Ë~c5ǀ?fe.cK31.GWQJY(*EO uMtcg6Q[]I/;G%3Z\`-,j@jO )YZxI#r:ؘƺUb|A$rt@(&^}B͞Y 8+?E:}L.Ш[qޡUeӎZ@TzVP+(KhOIg-:%ILZ%z[Ҁ*%pd@;* &i2ID9L7-TBR RR%:% R0AILD[ʌe(IJcΊ`ӢiP%%"BJfN RJ@'IKL\*<4 `@%Rηn'-q $k6I%/ IKD9 )q)DOrJr;@77J5N%3) J%Bv5͔&Y2S2B+4S6$rt5Vs-2ZאN$-E:G0QQxD(ɵ+pPyT^v TuBt.z3)TM:|-(*"T ,tNA*yzb{SwyxU >{f S"hiYhk=U:y~,QAJHXD8J@I+$7&(mW͌}CeZ (4Qw"'!ioG8$HBڢ)!ҡɤ%ӲJQpAY,D:RX$Q!D2uRRI$H$I$I$$I$NI$LIJI$d2(RI$8I$IH+8VqIAItZ<(wS<(wI,SN  *)e I$I$'" %2 AD)7(2TJH]$P)Q))I'L:dPI1LIJI$I$RI%QWpP)7RI$͍N-9jReʓ'IM84Q n:- JuRI$Z:;";F%*U)$OSeH[_no;tJ#qIJL2Ml(67;x$:Iq%H(YW^jUdTG#T kױ3)x[""v6E4@۠\ NGJRBxLP֘`yޘ0{zX*nhJZ!>)Pıx(tT P\S$Q h>)"o][x."imlLchEwTwO▥ }LkxxXk9  mm>Ѽ7 HYe04)M0eÑq'k[ Oէc%RN*k'U![d*)X$;h'XJ¤D7V}4VhQk!$ 2%G|G9ʱopU'ѧO%b}Fn wT D!}@Ӻ}Ѭ.kߵ y&F[ NϊvT ӓY}"Dk W M)!3V7XCu|\ťF st9I I"a7eM8C|eFƸi[իY1Z4JIRU-j -Hog }R$Ң:%0$9gട77UIpe)9g]lrO`mV/hB}h 0詴Z{_kkHT}F?*ŃSQ[% IJeBZ9#R>/5Q*2BT*I$S7zkpHO T*I e)G3ޓky#Qn CK0q*JR&^c]b\jOƐTܘU͍tQCUAFᱭ$#I6ە6e5!KMDUaӆ֍ OY$L$JIZft ;Rldr/&CdvSC} NfP8N}<)Q.LnshmhBer$(.aJ$U 鱍%tPn=ni#Ÿl3%-2IBRH-nX (1إŖU&=Y+M vJ\ܘA%O Eb%4l[2. !vʲIXI'L%)$I:d)$N:dt؈DBV* NQQN'tI:I$I$I$RI$$%)2t(%铤I$'L$IJI$N:JRI$I$I'I$R'LI$I$I$$I$H)I$II.I$S'I%)$LI$$II$铤:dI$NI&I$RI$$JRI$I$I$I)I$I$JRdI$RI$JRI$$$$I^[U:6()PI MZ$I$I*I$I$JJߒ+;[ AEWV-*LR4'(%p~$#['E[:"g8'"ea²l{Uy<]i-4 v >8kU RiuXkI8q:\ @ D6 1(7`Bc ѱ0eWmiX~@|ki읰hBԻ$k%W\-R V~ɉ[TmBV9ݫ:HTT :TCݐ4 (wVZ4IU@vR 5GH&IJ̟)d ݥF!i;mplv0P:$4J`OʬʬN]Rbpu&%ŎwO!`%o3:R?ghq )k=#]~[ v?r-@q流//ѱ?D}IݧnTM|yNSXMagr=?W@}8MIAh(w?:⬈DV77Ǻiu' SZtg kovk""KCFya iTcCt4[Un$h)=좱kJzwKIh2w O)@kCG8Qλu KzVt9k+/pl{t?Eit#en}k3tS]6\mg#ҴV y{?Uu#0)'94oh0{A)ݬ(wS:{ qDõ䝧ڠ%BHd新GJ[*@jaрySd*ͳX|]y̧d-6~+2?6Avn4,g+5|b}/k]ߐ,vQ^َH;)qH& gQ,gi_$u?\!$OYŨ6#TI,w^X骖 x)T~}1T>1&$獽D>Hky*ڹ+lx/'95F:XvsKߐaSF@iI.ou v)1 FZ{Rr"h,Ψsԙѩ+փe/@ʡxvKWZJ|t$?P~I;*>+(\9q^HQ*mŕq:rz/$|CU˞>̂x֒W;M`o$uݱ aVU ou܆Ld*I8  .|(@aɔCm8fU;ۿF< "u;Xw ,0Lw$$\TF >j2#No'J9&cPuJ#UgUCv.=d`j8bXyhF6qEA<|8µ`Tޮa}o*LVUG;+ #i=S5cTvq)Z#⥔8',P)MSWE)5|"{x͇Etƫ3*YqX܂|(<¯Yl&焠"STӔKI$ r|tKPF āLJv;RRAٯd@"9 )R2dI$):d&KI*NI$R$S &I"$.A:t! VLyNT IM)RI%2HI$҂t&I9)tJEݓ$R t(  ) -Z$EKI$RH)IN &&RI%,d H$HyI2tI$O)T[#$D>JOѺ I)QRqQ&PK=bTZR!4""JxH|I.RO )I$Iʔ%M!"<h> ^ J#wt2*]$7UW>$W\b3w魋Pam+O~ʴ|OK GԽo qGpe0UVʤBg7M m)xT=? ]ΟwErLT@E/{uo T游,LÀ*N0eJâcv:QY 2h2U.2TT] r{o(DjDByQqjܫWjWKu]JPv?T 1j8C}Fۢq/|2U3HBw(!TC|To6]!:fW1Qh^8 BJ`4JEQP-3) #U mVohO+hITXzwyڶմlQ9' Tl'r{]85wMF$I@铨&NS"$II$I$I$dRI$$JRI$S)?PI$I%)$RjvI%&)lQ!$N:#J QjArEH$:IY:I(9 N) Rd(G2I$(%I2tɓE I$dI$'I*I$xp[ I$z(G*RوI*+e 25%*)$N7H ) :=ԒI)J`7ot-용.tEk+;s;^KGOh],I)[ar.d PM^||Pw%m.wF ۹~PLwΡ%x$I Ry2׽\m#&t!F ]emnlOGD;IK[Ɓ&Nt&ӬٳGK 58S$yxpUqHTw?L5-N"Ήm078Me[qqhi%$/BM>)|T2sw7zT*6JXjK*ݢVzu"9=B ~t䣢D&j@Ί/֑!Yx )WDŽߠ$ 18Ais~&INࢆT$P5PsN%#$8\aEvP4#rݥU.Jp He GGdǟsy unx@ we`ɜSGu'Vpa!Q(U"ka,;[hɇv#X{{w2G!yN˝BpSO:R Ln nTpR&M jOiL>LN/, ' ;Rq,p[=(ỸGmJb5N 'xCy\ASp#|T':&&AԢ҅dgq]TupTFmL] m4o=д_uƉQFߵ h=mpԎT>Ԏذ :&@Rw)RS(BIN:JRI$tRI$铨#؈S(9EE8L$I$$JY$I$IJI$LJRd铨%2t$L2tI%)$NI$$I$I)I$tI%)2t$I)I$I$JRI$I$I$$R$I$JRI$$IJI$$I)I'I2tRI$I%)$L2I)I$t$I'I$RI$I$I$I%)2tI$R$I$I'I$RI$>G\T⒔6*IMZ$I$I*I$$2JRI$t~K\-Ҧ\+]E$A+Z!$))b%"9A5ޟ'O7dbv)Pdƞ()Uի )`t&bɸ hG7%ݻۑat(821XX{]?5[x1TNH'+omGժ4щW}YnȻm0uCԫ}]ݻ9ąg~W:h 6aic?,θƀ5BA.;=B#DTL;d ;Ir+/;7^uR9>%I=#ʱ適Q@R<(REjSpPI1`~4\wYI[] Em%x PJ ǒ|\S; :>%: ~hP8U8V( Z ]|XtF[t.gRi'Y_{gu.]Iu0֮8+'Y:ph͈Hz:tz?Y^d q?FBqkd ;y%gիZL`v]LY fK=4_KѨ*Ɠ> ;^굮x;4L=/q9XUu0uwQ:UVmX?! { Tsqu<S[YyB5lcKKN8H==]ѴqNjCwI+?Ur9R~kX:%V\uhR6{wCns`BG LY`t4xi;Ǐi s{c9UK䃠m"c不ixG'8[/.d4w"|Vd5rƎ|OV۰1`$s~2F}k*k'XFm6\t;*-rhidz3GYn*ymfyjSU_T \⃡U 04b&׍>- T;QQMD!P<" ӎ2L̈́"2C h<*YҴ^=:4!g=(ʬ>)#g` jϗ:ʟTxqh}V{pAv*5Uu;gI "+ wa\0a[*x#w~) !XCyT&74FD2H :䊎b$4Sf>$W\bt|O`~w[_~ʴ|OKV/Vz|[O}QU´L [FF6HN)!`(>:)w BNSa%4B13^nl'rMD4L=B&^[A.86QRN0B/%S )=%[H$ݮ d 7T&Ur`@LԩV$DDȍXD Œ*(~6( #HTw䟴(>tB \Ej&mq)|'/@i24RQB64PI Dڂ 9w &G,ʝwTϚXN:NSI IdI2d $I$I)I$I$JRI$tI*I$_ʊPEjI$I$II}$R銸ySCv )d)\ĦNS)$tL9 !RP A@C$IA1R*%):d)I I$$$$III!Gu$H(zzJ ph)$Q`ꜙLtM,DRI$Έ&T"z$I몙N,f  )I$m]h-J)|򗊼VHPesIh hRk=],VW$钼9jT# cA-66y#TJ i.$ڤIe^Bƿ㮩 /Oѳ_xG^[(BI"st(l\" &㵿Dxw*V, ^J@N@$s ӨD|k5vMjJI 69k2QݦL*ŏϙHxP;JS!0 /8G1SI odJ Iw-WDRb ۿu~@x( AUn qNQ<ΥY]mayl:(L$A cMoh=VI=ҾIHjtB;K#^\aCJH]D'wNJnIl{%UI-:n\b !{𗚖Je?)j!JO7pgB$h)&1; ƼAJ]0NPa";ʜrwQ>)RBV rHhZv)RM2M0u)9 i 4np{'Qp;a=NjmkpQON NB$nӷS!IڄJvCyU,|qQ^hPKunÕ1H09x׸5A-)CIVvNZ Mx{ JT3HCcMf~@/5_uɔG)I'dv*aQAd}d'PjR+A4*ݸ|R@Jvn&v!ofX2QGelLv$dx1f4Umj%)Dbz 7Cy]D;SJ4 Lecਖ[7vE5z.S0*h-պ)O|G$G~Х-="ҕfTNTE$Q$I'L%)$I8L%)$NN:#؈ b"TI]2t$I%)$I$IJI$I)INTJJRp8LI$I$$JY$Nd)I$I$%)$LtRI2I$JRI$I$I$I$$IN%.I$I$$I'I%)$LI$'I$I2JRI$I$I$I$$I$JRI$$$$II$I$I%)2t$I)I$t$I'I$RI$ʧP|Uhx{)A8+%ai0X[jNr$$I&N%)$WWOIg൓J= &I:d$H$ LӢG8 NH)(jLhp^PSN` pE(ELI"R𒔝FR'4Jda'X!@{N,itLHN5)Ӎ=W+ 4ly$4xhSP'`j,0'q`>D@:O\MS^eFѧt|w⨜m4%].p s%H0ZyUn0A2wZƻgA)Bm =vʤTg=tw(Y;)^>>aDδB۬scw0wi Ŝ+/d:Lh<Ң Q۬@%E1$3*۠4ΤlVK{T:x<^q N9Bu uRWeR mBc]qALc({ ΀7RSq b@{ xw('h9(?iJtnƍ-յ9C [)w;? SouA~))6Z4|Fʫm:J 3T!8 !qӹGK֠; Bwj*-ԩ ĠvS 'Ġ;rc8h2@`y)XC B3HN==G0k˲,3_{E\$G6u @cB;Ihm!ۺwhl !eQ"O=Kw ǚ ~%5FN9jmGLxO)GFC4M8CIg<7SMfS䫰i~)TSv|_V2sGF/M .uM4cX`٠?Us2tloyhWJ:ly$~jvG|u`I:|N!>ӻhx4GGKlEaȍ[T{ikG4;w)xUfƓBZ\whUmi.tk$BաžݵAf^6גA<^@:h#vfT我%6:''۫['$FɆLeϊj4(HȨc@#X)ڍN˲I"DƧ+8هhkH $=ƣ[$* ŸwʊZ,3Ts%K DhV]D].pEk v];,־LihB>ƞFo G~+خl4s L`jJ9"ѮrA/BJPO|}& J4{w6wu6<dA$Q*u\k";):7$@8r~Z*-<7T8G*n\pZ`^20 G-yig;u\9 G3PZ! +Q⁒wsgI-B\`|SO !+QȐD[?R ,BGPF|J5ޝhq/s`y%glPJxݡG%I6~J+;U=Dr\Bм(-aPJ싡A8QS1. J*\J]Ғjû.`RJ L9RꙤL$N"~R-BIH_=JI$I0)$ӄI$IKNA:I$dI$IJHӟ$RI2I$JSJtI:JT &N$RR8L4$I)t%I$))I$%S B})t i>d(wdTHnԡP Q /RAUpav;n8vN)!;DMa1 @hR O0 9JcNSaWku.X#tD4%:S>Rè:&esIO3 z. Ĕfgu IL[MvRXI yO4w BòoI )"HMɭB/a&ʿjk[?*ѫF{GMl_>_ w\TzkG~ʴ|OK\ʴ|OKz_ x,?ЎQ̔H n~ [ao%5ɞ63f"M$)ITMcJӢ]S6SL!=TAL*L JRd 9ɓ((Yv ^jKBUR%DS>B6OV\kG'7B51n&ip@SB܊c!12L:7<}|W90; Jw7>f]ցqe ;oPy:>c3X'~1MDACT&2]ԸXǻwhy 2O=PBuU`!;Z -ll:8ItSȡ ŭlgQ?e7@*a$Jf+`|UhH:dFQ)bI$RN%)$JRI$I$I$$I8I:JRI$g* vr$I$I)I$QA LUB C!)daAa5rE9L'Lx )dIENP> JΠj-p0 J3^ KρIJI(IX*%WC|R,&2tRSL%j$JtwM! 0l\%I$6 *.:hNLO)ZxJI%?PLJu'aA>()I$4ɇrJI%eOnI'H4%"]IRI$w*UJD4qJRI$`O&2R5䤕$JNnAXJlqФԒIko BhkGQsƁݑXK΃PE$I]߀bA XCF,sꞴ6RI$S3{uZn`YRZ-WE'INL x!i 67w9FNʝr) >dC ;<}V'qH8%*왾AjH#hQ8RL )6nz^c#rLS P`{$rq$kI xHxxN☷D$P#՝Px·4/N qLuL9~l=Ke9P G3X(olAQ;1+])DR8Npƃ {#]S]T4HR0kjgT:zv*v00^INDSoljA)D)6*mf1jOq!*W I VDŽ2Ȱ06Dn:%Q2$@9CCp=o~RnLyL ~>Qy(BN)lF3 ɔ)zvxp੿b{RR:jHL5(zn؍5jTlpu7۪[lQ(JqaAωG@HxyU gqQ) :wVǔvǏooŋtH#@ΊL %;%Ļ?R9i3q;nu6@KSYh$){JfL$ 4gdôPcC ac7|2VەLy!`4aZ豇`(6Jl=d1g|TIkp8!,#UI=Ա S;Ham 2'5@>LISGc8`1*౭Fu Um;?$f $L)T>`2u4.k#N?Tllw&epaX{3+msNKbj=G>{h"S=nT|I}3 2a v M$oJot [*ha=ʙ%L@:JE6͆9ǷSْ!kt wF?R}8#j`}T챕?IBZ,=`uVqI즽,1T b tj-n8_*nh%3*O42'@%/D@m`m?W?Ypۉ I|5Вw  Ip]nR s+hUS\l6oq wɅ1-Z6~['A@~2MiY}֟N+K4O[#v lvX]wW5n\sY܀`%DsNXlJ,O 4c5"HyI&4NONhwPJus=*T;+$44$k`Q/;ЃK\|`?1ςLBZ:ΟF$8A(bwCIEg)h>Io?5Ȝ=EN0 纐aÐyM[@SNpZV^SUKvMeˎx'{vEf%`KJRQKXWe~Br\ǀG&9?y 4RaL\V!Nꡯa=QKQkҪ\FHu IJҳ5i2&BsKIVޖTﵯ0&Ur'OPKX}%V mzs>k\ߣ[C6lkFʱFMGV[@QUrHTSZ\-:kwf\@jz >`A*T]v}Hu0VN$cMjWU]=s9[xs]{'(mn(#˘F!?D6|;=G" qZ5E9[MRTѿ@uvӧ՝me"I^muϫ{f|oS^}KOYs>+E4)2?J̇DZ܇30vɪn l>56e`~b-N>CZ.?40> <wLwT>YXH'AR^썎иeZn 5Z)NZΚ 5-%j##Jk;SAd·=^d>0t ܨXεWr{  7DA0J˱@y&ĊJe..q<bTY@GYێwu:J26a~HP Ym9᭿{A'e7;usUnk 8ԪVN Ja=2a݊%=G4; X\$NTkH7DO*!N;aU^PRd?酌ECjO: V}J;jt;)buiyЎ!vGx(ya`[Vda/\IHJ[kUh@=B+n 粄4t'< :VAT{ܮ!PDƳiHڙ=.j4N rqa]&`λ/oӯSuTJseW*N&_k9;*̱ȶ[HBαVW7øaR曄p x58Wu> uLbz(]8. hꫜI25*LL6*(x(EA஄ -`'!5\?J7^(4q||?"nG!1#>x$Q[okpJOu$w@ S`@&)Vsj!kbUיv>}Z;*ddDg8 )9*nyN Qs5 WUC@WSJN2iCtsnFE3sR7򒭶Jy &=P3@EB^T}`L%VnL#RR@KE[!9LΪ:#ABv𔝀H839i T[e\t4N# ?b>:) @<@  +T;C=[y7q=L<'m)BZ+VuMf~dfޞ?Ѕ;m,R#)sL|Q?u-ڭ@OBY䪪%.%9N%ۚ#lvـu+FM![U VZ rSmq Bʭ,l3jش}vƉfsV~Sp,'RHRWsVߦ; J%-+*sJzs0VH4+hY~qGOqtɟy88K`+@ro)o(کn@:I[~엤<,P,!!nJHT枓n®ϭ:zM%>kU}0X,3cU0w[_~ʴ|OKXTZ>'r691~T*WC$%7vcASԁUk[U *VʚBUILyBxȉ(6Q\vxw V3saWYU-Q4Jr1Q\bL 4B) H Ti'Uj ^J:U60ZIq4) >&?lb5@ƃai8aNa ]؅*h>(0=vEt;" MoP5dͤ!Xk6Wd4i091;1$V;-Hj$H5z hh>K ]LZ¨~f ?P nۜ<mt3I%Zdo$bSroiIRIRLSP)Rd(nuNy!%.dF!1 wIKSIGh1)jI$P[⑹JJ'Mo* >AP4E I$L [NJJRI&Sj5_H*ƃ5v$$!ʩᯆo˫B!lS [4NHu ;> IĦRҭIr3vFxxYf25A2U&݊[ 4B`f9S{FkT詧Ȟ:[Y8t$HU wP\"IHVl>9=)dx$Ap :-hx DQ(I$hL5 \B{I$JtE*I$TLKऒIMS71FJRI$Tu.8Da n⒔I(O ʦ\^ 줂I&c ԣ4meD,[LE& D$Ǘ0C@烢 UE&TyRPUBbtL<#) #k}O$K!c9IG= g)y'M)mTO:)Xp5- BLqࡒ $ر0hvȮ[뢕dvRGV wST\S4ٝJӁYe;Iژ]CE@ D7ݻޡn,ZsmeՌL&8 vẍAT.}!0ѥ]rRe rFs/ nk쮼S=R{Նfe['􃎶c X~aO&L8Wni5vQe2VAoFˆG}5햐~ rѡ{8 ,qƴ bxoh V.h,~9"QWΞ j2\ailK7_G"-o"Ky?Kˇ7un$()M;C&A)\podNBJX3DHhRN>ju6Bjg4N "!;,) T6y;"ܒBCDQB:)ku%5oj'(:ةp“6[ 4L (iO_xD OЦ'kfrpJpt2HJ! {)X }J`ĸHGJr %ۼ(4S1qCu)xv-R!"5KkeCם7BvճSVOd|Sw Lp64jv:{vD5%-;Te &SzcsxS@9Qb?> :&nvr J‰~I)~f.Hq3eK5NoEk J4\&Iͥ|;Q=cYGe˓*))(a-*\iu,: l09<ȍ$ukԳiXEN'xY$"Cp G$+$$D =“^Ob(xM a2m㾉J*Y:hO mEAB**EE2QNR'L$E*I$I$RI$$JRI&NLRRŠI$L2tI%)$I:d)I$I$JRI$IIJI$I$R$I$JRI$I$I$:dII$$II$I2I$2t'LI$I$$I$I)I$I$JRI$I'IJI$I$RI$I$I$I%)2I$I$$I'LJRI$ӣIJSaPRg+4x'.j$I*<'I%)$Kt-tBM )I$I0[O=Tf*Iիml Q )PK:9JJ &8R!'?a<'0m%I))NaO)3Z% QL\tU`ø>+E%5G 񢣪BB6qӭtޞ #"FS{YI+M8n:x&_HVk LrªsM@Щ7 j5WG` (g6:Hɺ5KBt Kv GOHqtDMFHN!;V4EǧhrKS>J:JZ#(.~ pcw;P56-e]hvøRyT y#2Gk)pFcp1ثC=34;w(\s;H O@4Y #l >7 8ƺk.-Gu y!cwYruq$yݍDtBtnst4_M{:<뭭kF׻@#wJ2e 7-unJ/*M1*lf .,[_2%$zpޥ%#a+`NFCaχ by:OUj`gs'N9Xn E48Ǻ'ߕ,ݔO2%t V[Ե@B?;,n\Ӳ >vKv:4_ouT1EsZp1Ǽj]lo+LrDQ%fRp4{Q oWp9"9ު.=P5*OQhJsPio 4(ա(0 Nu?%WnX!|HCʟ \Ou{!x~%IAZ ~eI5~'D'`wDx.tl!ix4xuO3C/1c ѧ++[_k>y]7G1Q7pxOW \T-i'HVX'GM f|MfPZ]0}"{O_Mks`S}T{ pTK.e[+:y.]w]`FE><)YI@McD'A5oE/k1-v<@?A(X uaΫVO* a z#Pli$jnڭCLsH V}Skt-v3\dyʣ+soao*%pxW}2RnYwV ]տgMTK{Ȣan`IW+ m6D;Q~r3\@Tr'q]{2UGL-mkECOܺc"vϒ f3nsuAt t- HT2- #bTƣS(j'0[c, ?ֆOVcp jY @#kdm=eu\kZ?lBqg6IVLf[GLx'UFf^ x#a%vS4܎ /{Du+Y`ktU w;qx-4Qpp#5S.iV+G\=xVo /cr7TMvG !Z#4BޓBKT:fe_<_<`, ,xШ#Dݼ| 1L AY-$mjѪv^ִ[O25b`|ӑ)`/ԨKxo!7ޑ_5+4P]ĩD%Q(cOַⳍGVaQ>v;VuT~U DZ@Jmt&ڛjpܞS-$;c(KrR)4$JJRPq)"RMI(I*'1qrJP. dN4ILO)lR&̨5A5jsS {J+qIZ">A/iH۷ q۠R hk92i?$r2P7X> ':O i$r*襌˜k Fq B%JWAGRY@a#@LS]h$A֗iO&zZAHyyR :ID8c7.?!v6E-&'IN/a|y'0Z -ܣ3;̴5ju$ȓWa阐/HM)s]_pFh05Sm1$L<ϣ/i]NwQ=VEicr y"xҕN4"[FBm6gS9ۄ08M ;DwNݖ`ĦHla80>(pi‰) }O <8S <@C,%OF1k.kHDPjcJxtjF O`L"n !%3 ;LwQsu-sD ?;SQIMǺca (b5☆4)BJ]yRw(iU?MƮӭMţ=ؾ||OW~ʴ|OK?Rrca>UT )  U fLr(LJ %^򫾽U 䫅n3%-d)1!*M@UY_EB(A!E(]hd)`h)B}~'\V [k|\Oꩾ|9?WwEOb&Y"(gE&F(9,n?Lr?Y ]Q'*nyktS!\򓆐t@X'TxL\'DTV&si H|tEqVc #rG1I 2v;P?6.|;tpNdDo-$ӧu^+8>0LHƵ]$ba%֞&y;`T|5Tsss9kD=6% O& (T&9%i4#b׽%k CuTH(&.3:y3k䕍-:h5 IF@k\\x< hS̉<9$rH{y&0dnQGO3C"SAUmsmIEٹdxhˋ@by.@2RVL|h`8 leeTM.gZwO1&n@?zZ< d6ܙXD߻x o•NsYBn+Z7>4sZDžv5xkࡖkڣiq4"C"^HWK@( s'XR1~xԛ' -#BT?Ewz"^L|r#WS #@ m&+aƗDu[!J̽ѣJJto!R=UsjSZR"I(д#%R]h zbJ:U{"W\!=a$D(W0H &IVa-5X' (ʅ0ws!n)x+w&PA-=VְnrQ6np;('E& \]#6VMSX$\ f DNFxxHc8SEKrS(d#[N_~'0;E4eӨenCgmyZ%fsO~[T#±k |˕2ݍf'kE 4{D[@㧇 ^vꐘ tRht8rt5],  ݌@u=iZjGvիF1i7X '>(8;IБ:\-ljG?[&T \s2ژ6\.%eO IMkn#p!cV[/k)lUݴ b7Q8u1mjVqsI7_pas0]afKL5wq<7Ut.{8`\'7gM4X7sݽ}/X9w׊ x-ұ*q+kZ63gMѵEj8֋,l-G[9 'k7~6l7 tkc;*{886@c=7 :{*;, z2;le1رT|V ,$q#_Ļ%E,-.-s}K~^Q' D6GWo^+[O1D~pvEdpk{?+;_c@uB plݴlmb^uSSq;wK=Z ˇV?)gea2x6Zus[G} Bv ׵hzɷR[1-h ުhuG.'@z$J՜ 1ze߲iJ;k5Ӱ:M]h [kǩU]v-j>FwX {\1.}MPvl0;Pm/,=ڴo5houm;Qs6n2Zk@Ro軌2=:Ǹ>_ J2+ϱ }l{}{>F4g,s@pk5ĸB#a+f[-pK?>v1lݽ˱TkZL;iƑ;v}S+]N9LTu @ma?^ S : ns,>].lHµjK]F1&`'N4Td\h։.l i*#@k*}# d=vNw rGE as :;SctR `$4JkƏ462;,F| JSuHhRN*#T!{|P2R[,yIpӼxS +AvTI)[- L“= xIJnca*,%^BzeU'pd sFtɚD;j1=Q2USZo iC`NfJ%uhR .J` .t Fn&שF` -@Z-ɋeF8ƈo!N)$:a? #Rt%J:JNԩp)$OP䩒t:kF0n: TE[5H ͊LyeQ< mWArtD Q7rT#41or x }p!\ $ٵ7{MR8m!?j'"RSgLnW)aPcۡ{oH7n$p׮ȎxU&}NÔȥ7^,,%!qo5BbcH?lBQR]2t$JRI$tRI$I$$EIJRp8QI$R铦NIRI$I$I$I%)$I:d)I$I$JY$I$IJI$I$RI$'L2tI$I2I$I&I$RNdRI$I$I$I%)$I$IJI$I$RI$$JRI$I$I$I$$I$I)dI$I%)$IVͲYU3D*R$D1 I$E$RI$SIiGqfBj+;GdkBRܙ$I,a<8NKNR08HKTJs $(\ m O2JiNBhJI%*SʊID% A:JTQڐnI$ *$G *&Gl1X$GUµdr l;Pβ[wKU vi T7VJvpY6RRaX0[.=&.Rp 5'DGmpaQlpcdLcBC4CkN@րٍ{e}Dz@Wp[7;s@ H]wT,3FeY4YyGy aeZ/^Ʃ#Hԏ#3K8N䍥ة`k!7@u*f]L>+/mOsPٓXnO1xlF0h z"CEl%wjUzv2=%^s O ƺAz+.lr>kGq"ڞZG܏D7:;G|${<z{߯5N2]kI hԸJ?t= Ǒ0 :b^̈́Cb2i%93w.豨Lhf$ kkt OEWY$ 'MԞuӞۂ̦6XAġ6[ ?M ot!9 F )5)R${ fPQsAWeuɁ:wN4, eFW=J${4;8cn yȭ絛6`6r8rkzŮk&c~:=-?W gm9[iS~ Hn6ㄮg~ :\f/w;;kA$<7+;D҄%-4hQdLz\|t CuUɝIhYaRKޘy}=A|ʅn$J.q''-A%v OGVR?:: e2yjq߼1ҽv|4#-ׅGZG?T&%sMn}!42k!iwc&0;k?]V]-b8.cXwPCP[IݱX{=1@; h}6N3> y̶X9C5¦]K}ĀָC9ի(I7<߽ 9,H{&,XUߌ/ltr>^,f4?LSfH숒F~ 7S=p#Se~UVia/;H#椏`˦9ϐF9=Guah?V1m-  }~gY~K@8;-W45\4=;g}5ܢGڝ9X.{7Sp*T۶ݑ-H*Ǟy㲖k7W-t֟Pq]ayPD$i7tërSOJ]">)3#k΀Dߔ<}0kFȠU,YΩoT%&A&@kIVf˝eRL( VwP}e-R 'Քgz5QܪEPTH* vJ\#<^hQ7&u 8wV>eNy3d9E%s_ѰC*tpcHY8UV}7 Gow?Hm`Gb>Nmv4I~j}Ĵ|*oɝ|JRe\֞RkQOFm@xC*2'@"G v;,\9 h4Xz $]pBgc.s@$@$Bu4Ш}a_ mw~Lާm+sqF-;v5=D||v3i;lsxΩ!;@ys,7{(ۤiv<ێ=Ys74vjo{s>IH&C"OՒ$O~v:`|.pdh'3Gh Jc.h u'U 6I1ۏS ,LLhc y?Ѵ0'܈)CAxQ2I t<<ԭ(Rkh9W\H?j$}H `ɠhp{ƜGT1f #4R /"ֺ8cw'DKFGEKw=s_7!=%I:A3rS&t,kNI_81#CpTw@%X[Z; ?v|/s0?:zh6[KH(n'[  pI:Oenksn#'i;I~X"u=J/5$I;oVyӤ~Ia,3ہ<Uc$=w;F2ƴ{$q?oP.jeл"5LnoGuQnq%!2KH5DGIm ?>+4bG*5Q@1šJͯ7B.+['-`-[ S!21 |AꍤT ;w#ձl={?v09VѠ+aQ9%'w^=S8Q'՚il7o Fn/=Gq⥗8kT|]zvR.'[onT ޣ7@eG9 ru y.J j-#󋎱U› #7U3M8 ЇedI^x(-RTm swl%UwgjL\4xm5< -.:~hX{|s7kvl[( $%ZڛQ.E|a YgNJ|C]M<g QhqiAGM<ܙ:I,'aSX,.:*"t=Oܣ[ 'I%a6?u= jI$: M:$IƥTC42vRI$i/lx"U iq(vQO'L6.wujk<#Y`Ǐ$j`qVOeuVӵ {CluƹpqigҬ_]54sZ '6)u*SP]C}}E~Mzp;H~MY{Zms sOj{wSC5ݩ2 ֹs(E*f#^\89Y_w1X0=}oOoAWma~ uMX٤d߷!E87]"l ox5P7743,=c@k;~o>{lU07u{{ͽeMdjIiTo5Wȫ(]eǏܫkI~Y\ְֻsA#lgv)۞v;"\{} ؛(9<{;mwNO}Wn l}nh%Qo?Ic?눐vSR̗3*v57csXgz7ٓXռ4hcjmޓGt JM{y$K3{[}/zdofZl~2Y)bY[?;eORe=d3`is͡?%[?+ωCNLQWҸuo?"jy t,}v?ٹ6U}{kno^S Wc.#ߤK2;0qϽ 1{pef͝q!K^UucisM[Yb+2-hy$9U?j!l.幵~%Pu\:ˋv,Ll.= Jz#. hp{knK7O1LV`1n*sKEm7 d8ca?؜ܗKkf}it'w#F FA82^᭱?|ZюZǃcsbv-?cn۬nMJ-vUXi s\jFnQW;k{m;e-ȨQְ[cF6{)~ I#Bc}? A"=A3`q`V^+VqsNCOg܊/99{:MskϿ?GJoKl{']8U6;IP;HMlHy2ܡ^; XDݸ E%zv"bQGkϺ쓅 {=[c; Vm 2@/X?G1{kv~~ 5Kq;@:mºk ^$ N:k sՊz7<w{ƒA49 7m6\TAiph"|'_T$(\v:;9ÿ*YMS@jDmnFw@^K:&)۪)z[ƪu+L@iJ ʋJApm)DJ*Rre3`d'kuI*;r UD$D$RZG`G)4BMR Ty);[8nh)R)GRШ̕&  Uzώ p;PdD4 N$ rkȟm]xVk$'1%.ک(@A)gp|wEğIcR?rt -J=R4_ܤSI LeK$B V!(H-_ʩe]o>H9 ;K&,0OVw09"T2TNk6'L2t%I$I$JRI$$EJI$霒&NR 'AJI$I$RI$$JRI$I$I$2t$I$$I$I)I$I$JRI$I&IJN:I$JRI$$IJI$$I)I'I2t)I$I$JRI$I$I$I$$I$I)I$t'IJI$I$RI$I$I$I%,I'I2I)I$Jn"yP%E5/Zdq'FZvQB+AnkilrfIDwU2, ۿRxRrgE1]8#9L1fj9PIyL%F;^u>=SIw?%6ْT ~cߐQJAi5N͇tNbWk䋉`:m'z {|fyqk#⸙lr-Οo>HbtFO_x`j~7bݸl|vfe-٦=kŲр wwBrkcD9ya׶52] Z?*OmhjP,cCtfݻ{}.t[2, jLD5Ʈwy~]!/l.#^/\ $3IЮWdCDG`QKN$3CʋZAR ΏREP$j|5{_Ms.W úgoՇk:v@;{y)9<%< &gK8h$;,֑ۧx}faPVi++,]2\cZh"F]Խu1?@V~rrE808G%=:V5l<CG'7/3;|F J.~#vLxxݓegctG9vUMĸhebvLx<%&O*ٲ@fDJS@><'h 69ӄ(.JbAH(Ksʌ:Jue 8;%$R䔋ALEDNi]'Tۓq3vG6Ͻ%?%R'* (`&"t *A'pc^{?$Nb;rir ; nG`&avH7@)(r!)wA;r;bgI!&PH qIZФ>;(Rc  L()SC)~(٣~wܑdi@$uWNOSwdV3 ZIY *Q&=(4D=9,@&tsiVY3 5?Ey: \18/䃼[fH2XRwV{^bU?4~K=Ruc6 *~V='|7ϝ8(Ǻoqr>=XAofk-m-=~z뀔tKicSg,ip\!a#=0t'iA{#{EϺM!5k5vBĭ$98F1 b [saUM=J5}G* qG(ɺy.{m,X 4;1oA]Y.WnQO.Qo0qdu {gM˚$׿ZDp_MwGJ./?Ov\4: x`Y:hW4:A84"3 `?4l/Okui惝Yx<#~m,?*o*2@+K9PbԪX|]PEwEwC߼$mi\ѠCIQrx˿)ۉk\ c DBP!Y m_kDaGf@;LI'*#5񧈅 }Sc`Hjt?-%gf+\~@:' >?EYl!V1U9;V9Ⱥu\g՗Fk<"JdJ+4)$JYI2I$I!E tI"VI$iJRRI%*;4wXn8ÅZ/\zjnw(}7vICdǂX47ϗBfX7oBA%Cvi| s涝r"l[Cpڡ s奀RmLyHO/hv{9RnCBu?g4}*'Qe5ҳF㽱(i|9mvU6@mU5QVPu'FIm];v$:y!tASǤ몼ޠMNe=.%ݮ` O x*=A% qu8Lܩk~;oiqvucL[},6VH3-K_.sOt5y";S$:uXc&?u5>!f ׵px:V>.уq#1EO"CF3ܡ^[ 5Z`͇8uDŽfg2\vtroahHXv=f3Cw v*.s\D =ZHw;wSSwXIRx+gӐ-vU_GQk>Uh밵T&y Lˢ|fbe1Z !h eߜ)vt‘mv?9_UKHV+v4@PCۺXw m-$ ]H4UfWPN<1۹xׁΛ=?57\AH`a}5t:5PZ߽TLu{k>B8{˭mo湿ZeRXiM>ۙkݺ?W럷h4+[, k(a@AVpswB;:sj{sq_b`qm9#{i|sێ3ΔukH{mBeb /o* ?6(W<a $ 碌{'s1D(cRd*US[[@kDb5*#i# 3MѴ@uPIN¯v1i g`9qNq1 k>_ Zn4L^9?j˺"pG3612v?f-:~).q|9?GmUv i/69Ά.:r"VtnY\IVq$ uT{LA LÛDl4Dȡf ]?bU\Lj3*[t5x)}Fᤓ$~r=lCeu0cPMӷx%JUƮ1wYtiw&? 0hGY%F<W~ʴ|]RtUR*?/Z{S?/r?a̾*HR wR|`}`BcziM)~*A#JSJiI pa|r`|U(9{p`I+g^R2Cݺӽ\D;DxViJt6B %I$4PhG|:lnhwVf9-" r0qL㦪LRr.UϩP@@{UJ}lD$h}`Fx,.uNԮLї R"%~9 Fn546|[T2 NըKvpO*OKL392tief2 !8­w3 S!{dJuEMYKRL'S12_›qST$HRCN\$Rd+@5lWِѽ畀t-,dv;!հ Y˻xB{76|MA;R*.ѧYAQٕaa͟E`Q-k"?"TCw=&"$xZ Kex/dP/Uޡp鬂O"?JyֹcܼXsgO5U$Gel@sMoYfG;Xh.'FtQhy% &w ie[)$yg^WY~)<˼Ȱ: CF|uJQ"K}JU[e;ZiQ y'l c􁳱KtYx')b?-p`ԡ5_yk`)uDvKuBMn%ǎ &O-xL;H ",q;rwh!ֈ#ग़`%6UVjvot?㹕; w#D!N_I3yd9wXO 7Z}>[Yɝ.Ala 7dzt+~ӳI Ѭ`k=PL5$'Y%7S%A" <+VjSN+w~I3hI]A6I-D M#6sb~06c-`wt(52I7O o)\705#MG8{X;v[vxѳnֻ-{)uőpwݿgbK-۸լOSc+u3 km~9 OMxdz~s@kG>J%5KF?W,]ꇖ}k>e|@qjPcIq _{3nTZsK_wO!eUsguӡY=EgVk62睮2b-v׌^?Zhu%v']&Kplu$I6- j륥7{sOw_Nks+ cU -tj??wQ ՑSZiZf{7?UzLʱGnjo")}#]zg^pwMoSmFhxEhx/stkm%og[۳e[_iWS &=N=W]8dcP]N ,/O~ޗuNSnkcg3^_2Mp{ڙ{4O?+*uSoqq-cGҁ(2xce}4<]H`[@MnȀ}}}KEEiQG ~^ҺmbƵ}'c]#OClƱhN8}?*9X{Kfo*_enG]Z݊D̲h.-r?Y>?H<\;9{Ik}9;>U2lϼ9XL=-`y>ǽIeSڱmv^SoM? u~Qҿos\TìġŪ,'q~ΚNp{d2CIc=ډmoo頁v+iɊsd?7Rw46C[jckbo]Y%,-?Gk=4\;()l'q RwPxlLP9(NѴCD9_Pn1=`DW}X %CΙ)spo~WsoPk&^e;sǯ>>[vFuo6Tւgn[z\.V@q/GWbs]G j{ݳiqpm+YᄎD[x ?۽E}m 89䎩 g:ܗ4ݔ=jU YTZ݁uWM U6> vPoG~Ck'Vʿ?Q2X}QOVHhk* 4uVI #f]b>ִX?Z7u|쌫zig5[?U{ւt-.=3z۲1į앛?H<Hah }o{?g_.QSlcvHK)ƻD=&۬$Zw^ߠsf*sW_MW=6177nq5%s+"/z+'?j.)-}▩&F%شo4QY_uUEVz}3w[_WXvWR}-#T\Aޝ-oOSd_IdmWգ-{Ooc?w`hk3s?DfK<~Is4cf~{9]o u驉?bq}˥zD%}dt\)d`{;]"?q.dͻ).kifa #o6j{2F@xt9>@)ns`'rh=氿Sh2g)YXY=v+0pbb;~k'du5 ^AsQ]s0kGygh$bڜS5`-k\4(.肘UMnFTQ)gQMBIP0.*;T8)ȆF `S2BhANe.裢IrN]" n‹d⍦%" Nuw qwhT<&Ee?6Igu;cAIXRql8k9(J3?HUZH-ӿqY?x:Q_ y$ɧGX Ej(K%:'&r' o> \S[6Jcƣ$1)D(K)%zL̦`#NҲN8IHJA9L2N:dI$I)$NI$&N:b3R$%.I'I$RI$$JRI$I$I$t)I$IK$I$I)I$I$JRI$d$铦I$RI$'LI$$RNdRI$I$I$I%)$I$IJI$$I$I$I$$I$HI$$I)$I$$I eR{u_''|BJRL(4N:4LY%HI*;IJI$$I%)$Z'蟊|H'T^ BhRL$IIE%($I!INRI2ILRN2IIJI2I' IK7*I$EK%)wj,&xO EH E u%=A@{, cM q RIM[H.'Uo5i@zu L!۶IUYQm 厙>QK@G…$ƊU{ wJN1T*%T5^&5#^Jou+vH8yR[Y,sYBU&v@k$(w@?M&eG(XxAS @P1'Lr@||@cS[vibMmviL8b;xV{Iq=A7jF 珂qU#c^.q>1<{ GsoV]kdb6F?XI{i1A]{H0"~jbX:~)JCM룍7">V,53?7^{<“\@D҂7$lTƹO>MQ~ V=^u^]&|?wLj6p: -ӈ)\NjVc{C'jo}o;,Ooʭ9q%PʹtS|C/ #u n>) kN oNx%w4+Ͷ&ZoYǴc 3tr":n3 {Y[ழDVH㌿zK#}V55Xy+çsZ;l2k`c@ <=`(5J3[&)&%Hx)7A u8%&HJ7;~U6 Е)t %~ 1IR#~EOHyA y 91 $.5NxM?\Q)S %#\ꂕ#MS rCRWgJ; /):\%8$i%,y> iGOIΚ$H*G@jRC)|BkL4s>ɥ8PtDvQ k)kL4)&!>ޣ'TȒ4MtBG&%IJ$H| xJmĝ^90%%()QMb7D!IhӔ0& CNTKXN*ؒ7}Sk@$ptR U{RN!&蒕 _H*@GkpJJY"S(48Db|~NmcTײc?$ qQ I 9=Ӂ qDF~ :|@.j,H?6㺧lAUouQwNA3FUY VdܵXm5zhİ: ck=n96w~j8nt24:Y?~C|Q M[ZvT}*A sA_n&cIAoguˇً$:~5aN$qթ}TzQCr;\ւL$wAhp49)ͽMRjӭIvLxjt}6#3Pl aA{(&vC\FO 1@{Xnkg '$܊+kIy -=;"7= ~iS8# s)K̛ HpcP݁cQְ=$I'Iw?$]icڬdfWs^wG)/A$&v:@@}o[XtS4u.~F%N5c}\@0$'.mV4ZS!~zA$"% ,HĦoK[tQ-{vO1W6c$~O 3l wFmx1 ŹW'B~> 9[Tr mɃ<x@ѧVkDYOXO[hAAPť~*f)6ˆΧ~PPl{ph-nh?*Vb><R tUc-b$q+bֱH'YUB 5k9QEbNTc*tuû\@%3u~/ *48_h\J}w:>[5`g6'P`$h)= ?\cG٠mV-иB h|:UB=4@F##{>;v2b=>ʾ̰mF}F=Q8Z8)l$(%7I*$2DD4D6;kh.8O2?u ʈ8o>O-eTL61e5[Uu@[v9Iy%Q\*εS`l6tΣ}K_b~h1dڂ<|YtCZ LK.q; uS],k[ȧiypSfiiAhȨj^Jz+ =]^:Myή%[Gm ej?C }ݧܮ*u`~ʴ|OK־ՑKU^a8W/OX?/2lOMɵLo/)IQ9"t$< (R'ST$v gK?E ;ÈRK+M$xr)/1HOm:D \sc8$< !}kKP .%RuZmfߢOQʣ;?4g$FKeB%8BܦO(l*hpUH6I'UtslBflxʚ!J/)&+f>0$VOb2 Ykr}'O~OuT3dS5pw.rѻ*Z^`S>j|^+u{lil{%fӧ'@f" y\w{AP[L++h?ߒR 8SpS⃴ߜ|avVe*hw*nRFYJe{I5SiZ>A֛]$RZQp}Pli$[Jd{tOPl@#2LѮ>GW(vJcn0L57DϲHNuD9~hGѢ5IyS'qʫas&~ L2jh{[`< dp\>h(鲒I:#۹)'OT $t#U)$ S5nU,1Ls#";T bGtS)1ܩcu%Bvi.))sŒnKtQe~:ʶֵ;pMctN'D2dSMs hkf*Qix$ (T0T,b5yZx  @Y58pݩ$ rZ EY?Ag[݇[we<{w6Jx41.k$9ۚ7zU>[)WFR@,9?ʓ2vSw4 t ~k~Pk{_zE^m~:ـl5_S7֗]ߧ?GmrAl;9^HW+csfKϥY[d}'>eӡJsjtza-^凉LM]2Ix+t75RZE[@s|^{,t]H$I3cvm~c?&dE_hys[[~*g+VnRpoVWE4ZZ _gES=ClBۏKT%xJD=cmW5ճ)vSqO]&5ys{q-"b `f?;)/ݩs;Kd?Px٠s[_EꍩS:kX?׻3d:Zkanv˾BChɾ̬}0Ii{Тۉf^Q}Xޫy$=wk{+>}6;{.q۬kC _1l꘽#5e<,#j?aV=rwĊFYfّk?31Tv- cX~kh7Bon*%u7sc]Q9 s.?v>3k8cժC`>,lGے48 C[7գ~},šU d8cd`Vjkv鵌n?K?/Ta4}1Ov;[[v\cmDfEwXؠ܁vPt 謴uC>eG՜g˜lqC=]ϡ\UFU9F6c,s] G k]#G=f/{)v\Ѱ[sZ1`ѰGʫMoE4cqsI`1S}]OSa\gp?firn|klKduj )k*׷e3+8Wrsߙe /uVVm"~I)Q`cqqeSG[N<vSV{{wrΏH=]NjN}W#i0:$2>O[]?%ŤpvnKw?V_TشMaclN~mlulab궰77wX[f1:{66VU۳?[o': 2窙Y@9,FJ8Ka=cֹ!.>?];O5ms:RfM \]h߹ZosX8:{U_ؠsV׵лnbamel dz-`pgqܫaaX_nEֽĆK_P6Cģ!sIk7/jPWu0lB`}Gbv^ю^}:tՏ>cA~@2OGSN~ihH׳#X *75Qf&Q{S?ZYp 6=VOj^}&Nِ ݕSzծoQY=\,!ğc7}kzVevV }K ITnn+dTC6_DV %=Ob}3&7!8}YAsj߾8;;PnŤ]ŭ k0}w9 y^۪?7h?z{~ڮoh<4Bd{[ ?k\${8׺`pz{^bk {Ӎ->/85a:/~fOOs6Ŏp{\w{w5 c=owIH$=B`g*&^CZ4M Rp1{'uӖgx t =ߚGQW|{, Q~X0I*C` `G3IԀG)\^w+}; ֟+mkIu$4hG?tx[6t|pH*P*0u3B :jooc];-~_~6GAc4[7mm*QX=}7" ֆZG)X\CIQ+~zvXƖ@D\:+\gw;{e~ /kX-}>5#&^%I??jCA'ѧiTe r)v(wїn'fב[{A=ۿz/Dy(T=Rup9/ۧ 8m%ct ~cQhZ 'GÖT$˙`PHACQ ӘQ,s(3?zon$Tɼ' spR)abSb()f̴ti'L1E I$I$RI$$*Rd'L䎚䔲p2dR0x)'I$1JY$:I8|RJ$IDe۔DIK1B}xCI;Z`L NI$I$I$I$I%)$I2t)I'I$IJI$$2JRI$$RNdRI$I$I$I%)$I$IJI$I$RI$JRI$I$I$I$&NI$JY$Nd)I$eO0 ⯜=6,B56=ДxMS4IZ$jSWH~O$BФRd1 0k+JRtZ=' ZZcTނ4XX<%)F;K4]ЛL=`P:(d錠}ک&MFODe0U7RY DHJ/m4NZ[ϒJ~Ș?Jfp0P%=QRT=Q|Ȑ0)ԅGR⒙)A״k3QvKu}1r J@UsՀY's\Scv9ɫcxqԕ[f6a&n&O4' p;\7sA)CcyVƵ} X*I lnN#-uTSGdϗ h' pg&$j׹xS0q$XZ8G@&<L zA%%"{Xn-4QßCu@7i@Du"o}A^  3c"YTHIKĝFGl:?G{Uc)ߒ*ӗRS^;7{ufuVWݜ{@ LVןkR<\48|<kE9·E`qbΝUc{t n?Z/eX#ITIs ~ud 8nZnm'a\D]`-c\}))F!A@uy%ƇsS(j9gtGjYvKX bΥlOl~}ɪx5F&SH:B[LR "Dꙶ VII`'} Hl$`w!I6f^H. ׀ %ݴ*r{Έ4IFR;VO Iy$>j 41*]:<(-{&3v*-C1IOmxSȟڶ8A;Q:Iw0wbk %JmJ#r!X>IǗVs,="FgLHFu;LN8n(it>(iDē+<Qv%""[->c-x# 6AD2PrSi4Fx 8/Num'8puCts<IH}S$u) O ;!Irp9Ӕߕ4h-yN~+/$`Oݪ\jyJay$$ v5~&{|HK# Ʊ >9'󄔺nR)Ң5>^I8M⒖tM)5RNZAEJGLrNܘ ~N%IO2J%$e ܞ)Ϧ>lPvbOEGI#xZB(CGq R/%TXfv38ˇNG+?34Ugp#%k x\&[UkhB6R6 n0 u!-'7"t+t?KP4ZXw}|zlP 㼐(#;usIM}^uU<ƅo]K} N'݊˞Z'!Tv{s7wjBl:u&h L<;wج}KLv\9KBF5w,n_hp0L %{ߏI56:h_VKN?kn}(DJ~S*7$K\fW(Z]-Ї xvvMVXScMgT.$uZ+هY4w'#FY=1iwh6Iajm`h{,γF8sؑYsqZcB?c~/]hG Mn{L婑uW}ORc<#o5H wfOZ!iGҭsI'$nXd1ۯCCC>K2N Jm'7z9̧$px-Tkp O=㵩!4UgӼh`?zڐ?ZHЏ~Z/-9;n DNCFT-XL>']=6 G$ =3 4M4~{I-GMZ 5S #A]նXt,AlU]Xk}#Eb]wB id'ADj^eXUz,^dzmS,tVv6V٩pU% 3-8/j%f4<"I#B 0CnÞ S_;S@GӨԈ?wߝu%0& winn֑ȟ%EO7d[q!|4Hv?lm4߻ee4L - p-"A*8:}B^[cmu3unǒz}hL(t{*;`tDPC:\,qk˴_M64fKÎ5*sCZ #V7{x[0E͛+tgZ:>NO 4/Mih1Ν֎,l5 T=Ix*$KJ:$qDeFh3w5On;5=\@Rk"A''>GQem$: 37w箍 ?mItq3nMָAok7~=ZgNib¡ds3ODŽ7Thdd~2 *-Rsm4$G􅣣spƵ.%mU=:vQ퀗r"?uV*p$K0?~v!Ṣ7125!cd@9N5rmV{> vnWH3en5a_H`WJ7{fo$Z4;t#/~ʴ|OK*?/[ZK\?`̾ "Sg&7)A4y/ȒJS$'IHO K2IkT~IQ !_V<[`pJ.Z+pyDeDX~>iW:i[X-n h8s9u)0|CBA#UJ-w??ªǺ$Vu>^I' 9=YCE&k(pf=^c!vw, /~9SxߚN8?{F( ]+s*7ӯE .:*{s$򐼃r,MaLj0 @$rAtnN)t'AL[?GU6E@^LBrMkC`xEUv̩4@GD|a8#ani]tτ\}+ 4 (?Gk\|=%zw ƈ҄|^F%F˫;y ^dhj;RSS\+uxm4f0AuAh)>JTis$7]FͷkP;H-":[HGnkfꋿ9ȕ㘉=K"j@=Ҽz`3Tx~K_]*4~Oz]긻Daq==ua4DEp6N0si)eud> ]D{^3u@/68h8Gs=424Ou*~ܠhIAmw+:vܿ6:>ZJ%\9> ))!-5qP.-Ç)\C`wY}PV eZ_Vj9|i8Y8n+ʩ[JC7 E6RL{+ߔ>P:8| S75z8Ș"LG(^C]~RIS &vT ˟5sdvRGE $h@Qk> %vE II#$Puŧ&p5 I#U$Hi`i!: }3I^ H'N^=dj vBOLg *N(#EI$*3<5RI$8RhH)!p I$\S bd!kIRI$JJaؒTI'`L;g=&L$JGW"CTX6JIIIiz%AӷhA!I$`}gRTQhv-ъ5#@7\t-nVA3Y*`50 |ޅu7>$MGmpˎDgK_Ys ^[q;>*`7>eu suavmc_Ώog~3xu{wl[?ybclZKϹ?ѫ 'Mˌ[˹̢r׾ZzavIϦpF !fcq`5ʷ FV^] }Gۯm?5Lui}5瑽w~*.Uˀ?ا~] FeqaZv _q+cZAs_'ܗ52 mokҨu7%Z@i 7\o}UzVq-_?g]2מ{s N9'~>.'Ne\I3[{ WYMI>\NK ]r'#M??r ymd٤GU/7k@o{gV[5Geaͬ8^~g_l-ݬ8ungܮVNOzzۄP-'znnEᴴw=>o}׸nu#`N|H+g;u,~v)̹Ů[iKq1Xrf̻.d#Ԫ~bVNNLmfM _o[ ȵƬ}dN.ux,^O1UMu&Ɖ}[?k}L`a`1߸ ,3]`\e;ɒ٣qukv4O_muI ZۗSn6Canv5?qPVΛ}^-3_Vkg/?Ժmdݬ!O̥7Qo7='}ݵl;˴?7{˚6.(}46BBǢ.'ۍ]EF~=O?1} dgT ,òk5ǝu۬+Naឣc7Zӷ5 ?8VqǦHEf[MX?He[c*Vq,$~`?МY::#Sdр^Lέg:Iqrj݌KU at:rl]]`\k=gzv1I8R/sֿi ˃?6Ne{mgãZt ?w~_ dU{]rөcؓ[[ChԀ SИ/B:_2UWO VCvrFֲh2$c7t]Zʟk[m֒@{[#VW:p%0Y =ġkKw8ư>_GTlt:uu m%ۤ!NM; deg:56G?>Xk~E}T X[^n6vi nLƿ'95u M]o%bƬ֗90 &ZqYGtR~ ̭f[{4:jSQ@a"7=?oo;(4s{1{kǷyhk9l޵2g l,֏sYls}?Ѡ~kuѸ׹?g}]n̲AeUO+qx.akgnK,hqs@ ~VLpUGO2O,&tFY`vmV}]i步'߽}K/EN-7کu`}_H]q;[?T;{~eVqj7t;Xokve`F~b]8MoqhI-^}5KFֵ\_?W}~6) k=Uiwojջ+8@npwW>{q誊[ n=OvS@ի(m-0 G&. [;?+3*Qpi2Oobq[ﳊ~첽z~}?Yi5s7+bOszwGdzf.ɽǍF lzZZw9݊ #Vu@d3^@Sfb`;9_]Uѝ`uoV;O*=z}xk].kvXucb %vv3?jG ?օ^3ka/ѣN 7MY.qG櫙BL VSf֝_2]Ѱߖ d8^OSQW^=4kZyMO,N.U y?I16KusstݻYmucD?k=,pz#&Pcm;hz܎zkA,~fR,@WN}6ge Wf7ٟ{8H߻C??۳-/>ڲhv6U-cZ}1.N&1!DZsƻ}OUxcePY?VpsFL A޳nՐ1_hNGL8*Vڟ܂>X"=_S?γ1)k |nq?N_Yj ޗ]Hy7}FktNfݧcj% Ø*8m2yJ$5SЌ ^XWEMGgfbBsG۞MYsrqN/h}9ONӄb.#Fndz P}"ӫ#gy9mi tˇ_%04h Sjvø=h}TOEC'Ӎt.?Oռ.`ȱ t8cwߤVi]1^\?nkeIi蚫5:\,6zX[& H ?9PwU6C{6Z _;ϵ;LIsOڝxbI'8b gռ'=ϵXMw~c=ձG6s</!kw+Qu,=D1<h c6{?Izjv0.$ֵ_ έ` A3dOܡXI;_o7$T24@ubSNkMW{I=YWjn$'o#t1SevCv;_U?5BQN)˜KKQ_=YZ/$Wn i.s\LZƙob |Гޯ Km}NU:Y]B ~KUV]!ƭK)WJ\Ow,~kKrnua@wW?ӲZvQmkZ`a:gYc+k$4kt}Xu[orf# sGV~&8E?g 웧TǹD)_3Z^])2CT>W];mvzgS̽0;Is{1}Gw8U1S\apԻ[e.3o`N^hqe${8Fjv/uL&̈́=6s}ms}Z{qo-loy?gQV~u5㚅4n1>Obn- A~b5ᡗz:_V_VZ=8S)ks.U3tpphm;;@ɷ)6k o_G/Gzw:}Θ?QVӯ([sFvP?~gE 1(vٓ~{_[ ]鵠*u &A{8t!ipDz.ށ l IU+IkK"H۾?\6}޳}{l{cKH#Zofz5Xڞ!<{4ZUe,q&ww=A2^A1}vYe{Y?w^ۉpo@Hlx~ʭX1qʰgh۵?z3k)=c~g[]]u3V,'t\ $*7bZCC:Zm~yu7q?EGoW30ulEE;?1.z}d€K d{6RUghƇm=Xxl~?k||sl6;!lukUsƬj {Am;Z]>UX4'"F1--x #IGeX}/:|H9 3Q/}V>q5.k;76URkm6}]}&ҋ>Ϗ[bVӹ.w{6nYkZK+Bkc r4GDffd Q:徿_ k\{ٹ{?\֎S.aۛkY7~I bսix81ayk`$onSO5I4[9eqBak;Ro7.(-k_[}rţ2\gFn\N]E&Qߟ%3l#i:Y`бΐcP +I `Em嵉 Jc1:|5[n.emc׏K#~OPo6A#{f;bƺݒ< c|?*n'Olڲ8@rb>^$4~lG}n.϶ (^[fK +pk[YuSzSۄTq.qtoGI>j;iIh1 uνI~l} +#!M,h. Ng` *sT@:?9hCӺJum[SvZeߝv?H_iC@f!4;FoE02꽟ֹgYԆh,ޣ۔6 {K k]kX;;9ֈ/16#-r&]TF=49ZDv.ռ&{ֺeeŢJI$Ke$I$IJI$I$RI$I$铦I$RI$$JRI$dRNd$$II$I$I%)$I$IJI$I$RI$&NI$I$$I$I)I$$I%)$I$IJI$Ah*Ί$)IgMS4I7c# )I$[S};!`RI%-8:Hhat{_=uVo@V`U?X*[}SNKfpWU\'¥j?nrgah SzS{'R9_fr6Юz?uKqJJVsyZ0}&J%+*sF!hJdU4̕!\)U'DpnKr6iH cuZSBJi\KD ۺq1: m#P>bI!Z{`3r[qU~M35*U Z#Y*v+fC#Q7=Ϛamm$#X](?"Q\Lq4 (ntDOb4R)pu> F&*G]ALi) uʈ2 $k&SF1z;o`> 3v4Ԫ.a'ݳ(4@®Oۧ$)(uĞ+uB'!䍣O5)W <$鹮㢙c 5L7II|$U)JZ&|ʱUeAAXsgTlh*.lH8ӗ80@Ԑ;"Lf?ok⒖3|ә%(S67*tۨ$ \])`$%Pd9~<&ց#9ADA:p9lFi50G$&OF@ܒH>s%Z~ܜIc}I*^ljGp\ o\8CW@!>T I& sY~6D5h*MT7:p 2/iʼܗU H(վ=CuU{Z]gJɝ!G.!wS#Bt(MoH w~^4Êʻ#9滠AkU1Әִd!V NG'Ml-k+b'_rkUWC̏?#X}Hc? e Wnw,q5wv`{02q7;GTTA)ѿpL+1.kkaJ%9W2Gэ5U cW8&'Yv %Uh}I>_%{lqp̋K>?ZN ή t0\<2uOt$՚-jv~㐜oLShoy u~ p8xG3:N-Al$9߽gSKNz>D7ΐ~Yt,haYȐxTkӬmoUMaqĕj/m0[Mͩ: #_+&Y^SC9?v)04hL {V4DL*9l1a>"@mG"%ZN1eI0bO%')pax5{k{)bt0Btf=}ՖtHc{5;[^TǵT8;1TPuבA=S9Us'OաG@â_o,s.vGҳevj7D@W.vX#U&ʉ!]$kчڏ!'Fu q{|-%W@#K~ʴ|OKh>ʴ|OK8O-OX?/##1Lo)8LM !/I])L" IKIJ zͮmuH ֋IՍaǒ8ڳ-̞]Y9XSi2ɛk2,#6pprI$-NcEH: u>*H)$P$x>k"˚4UE BS'[8,ȭ#Q>ѱߔ* :3JE`nzN'Ŵ8x-|"{Ou]K7ڠTIy:|J I<+8{L.pŬQ\~s687$l"؝ 9w-,.eN#HO^xn'ceT, ӝMA|)kDP`Z7YV. aR v蒤̦JkG3KX.1[~e ܂k#*6t 덣we 6! $xX}?qt /yyj%B'NQ\R`G`|-%)w26T`RS+&NQig @:sG8[&Otic Tk~OeLOu: +bmp A[2B9kNEC2[e|ĢNŽ;wIĵL$ Pq 9DXԧnאϰv&k@"y=`zߑQɔw*KA<*N& &yI˭PCvSd\A#w~{Tj;]tMKKi8T;"JlB{SȶtsHI?R0 '{DI •nْAw&|BIRA"M[Dacw8 xžE|VIOd[9P{cRaIEAt*9g$ˤXNb]$Hr#D@P I$8Ɖ 3(RI$O 5I0Ԣ5%[{-!$ҒI%R k꥾ $I'DZٷRѹȯI'LkdyI$PӕITl%RI$J#*Ή>%H$k%3Zv虎G)lQ%#DJg>}CI)r-vK^+t)vL`,4L9hRĨk*ܩRSwMcVZ5%4rUvZּ4|֧Mas?ZdWDNmAYrDIyL+ŤzX;Oo%7SxvDaK&;G<ꬵi. NDv'YgҪ\"73UkitG;O;W,G?k]%Ę*6ZXC5b Ȓ|?1; (,w_G :@hq;ci pu2 ";h=M71K-& GxO!;?ԍ;6} /um qm b[kk \ -$f.s@kioT>*fs簻{~X[smt:{U#.{ksO\<|8xBO6/:@}wQMƸ .&wgAI1vC,kO c"dVʃliw fR뙏݆&Fv9:n_6lhp46Ҟ[m a -"=n{_q?NH?{\o{W惤*s,|{}'lnWq*^+^"ˬ?~[g R{+49iIuX Fw>jg>t9}_ެ1Mjf]i0mcVz~uZ%~rj{o?E١>,k'y{z^*z% ?g:UgK5vîe[=0,ϴ oc3꾗ZCknOAcoDn!)C6OuG}ճvv[-i~畻I7ө}/W |~8`s1U1Gts_gٸ[/}g gE<6`9i>Qcjn ?( m\S~Xs 6#5 Q[ٿԽ¶6sj] )nMǴk9~T?=#fA5SKzZuNhshnNeol-[v>(-8SeMc\9 }'in=@.sx r7kzIҙ:sC)A..pZ-~̇\ ?fk,its\~구EMO9cUY.*ΆѺjã p<u/37~6sx%9C^b{=;8[U`?y{ZCdp'ulAl5wz_ًhH\DsFYW}*恫C09YUN nZR{WŮV?A-Ol;oWj1sMY1]bNsRN=7_lퟟwt[JCMΟ7_M:V yU*C2 ď̰$0F?~blG;v t @ܚ7{tcdzeܮ/4bjq }:_ԵO1XݺX\=0 Vu{X-{YO"h|t~UPUz q{)e"}QW̆Hk*cGC{7sSo'en>\8f}-O?۳0aclw_mw֠C`utCфvsx'z~cm۸i U0dǀԍnMX?R!} mEVǑ#=ο~-mohyU˵RiǶާ[KY'αA4h{`$UuxOr$4jZG) 苩ݓaps3?GVVS[Ya۶>~buk}߹ŝyxϡwS MIw+7*8>2|UѾ'Zs?k3эr-p s?-ؕ]qsQ c_Ux shD8[=6Fe<=Z9LʜkM[+c~6,% \7i vԻ)U}c"Ls1soXY[^;3f[??q^vZʱk 4^)QtHTuB'.MZ%1>~MQ?f{g'Gye2t{?=7Q+)mۻ?rm'F[OiNR)i$D ,kfٟ&]L}>$cMO=dž`/nP7e0;oVom}1>emy؏ml=Od/33Khk'Yq^YƺNd7z}:ٱ#G; st!5E@1}"[,\m6q>gJfcv@ 5{\=?o \:M-]k[I.o~e_^MEK űAV#yO?JֽTl=,0-O~>]NCCV`/)2U]c~E+}7J{H?^X+vrk#7Z:61x{7jm!Z/#ߙM5UՇP%hS5ْgh]b]d$ko>ېGZv~jEl'#d9 WO4lkɭ5̤ owqzs=jA陵1?{gVų]s~=C\u?kv wjXxbc/yٓ>د'mU7aϥvI?a.A`ͦ /}j~(n%Mk nU_YDYx־׷?bbYAtnsr7 -JNehoḉb:HPȾcvA̸olGJ.w]{h>{ƒwlnG_Vn6-WzƶƝѿsk]mM~8@ѭ~{=Zbc\rm.i;}s[a.#tf3.iũ@cD.<9Impѻ[loނꩧ?MʭN[=KVul,s gg6zX{v`Z}j=LV9uG:6TOXCX"Nu5S'kvޓ̫MT`\LDCC^. 6O%FƢm}{Z+IlӯnwTҝpϧ?#cZeT!c>گs5SS^ha $k9 ܋^Ũ>%R~4ji [6 c]e7+Dk2on5Φ6^Y?zʭdUmZ!{9F5Πqzk?R~wM˽<1̆~X'>ֲ8t=߾䱖A3=⍐[ bX崋;/IGqiNYnNN8Ȭ;vd/&-m'V}^^(soS9'Z|6z"% NRݨ[k}nwwD>M9AgFWodb[k3v8FV5l6`'@4PqwH*]?7ڬW.p Oġth$ ֬3k1Xwn}Gp*p_BSqeucQZc@6hC[cKNGYu9,vyQZciqxa4.; j$|j i mu:hG\FE"Z8L}5☳'qwݪϪ-xչht^_EVe^O~,,QEx1pCI$uI$I$I$I%)$I$IJN$$J]$I2t)I$IIJI$I$R$dI%)$I$IJI$I$RI$I:JRI$:IRI$$JRI$I$I$I$I$I$I%K@WU ")Fp$4LpSP$I1I"I& ҄RI%ҿvTP̫ B((JTI*EDnɡHbO*"T4$I%,IH!1KpI"kIDJRiRQN1JdBp' )RO 8I%-3{iB{N57 uD9Vic; 0L+L{Xp3MFmWh0dXlҠ} )RxMVЭId~iTL4aXih2p/7xl!q& ih] `:rUv'#]M 3%3CwRc\A45nդ|Usi=M$+Ïj GIRgkZGkpls˷TÀHw(M1"dNڷ<F_xTs=E46 <f6wykb³'= 7qޗ.C ]/춚Hw櫙)(71Ht~NwP`xߺ@/G\^iܓh`s`^:Q{!O0XNxP5" $d䨧oN;rI)"mbT>I)\sEH(?%HOÒJږU J$D!S~I%$$BD&&5_~TSǏ}@$;c~ENJ2{kҔrNN`@|S(ڛ!

hE$%2=詃vC@%0ne;h㦩Dk)Ν'!&4VNNnrZO ) #9OnNnp]?}}ݷ{GuJNnyb8ZLn*ŞOexh]x n laI3"XEP='0RulV1MIZ%$ZI"Bd"םdO-kes< 18l=@!9q5BkADe2O14f!.D. @#cpfH4D!i)}o!nyNs)f7cuw=O)5[rt Bo j<<7~)d) 8OBpHCILTXLKR< f9>5 惨A1ԢHt(Lj4: R]H6]'˄}鄎uOw-IM.[3*.swߢ$LS򘷼2~JLsO"~++>^ `H'$82v$X:;BI )t):Z@S6dhﻲk _2#))RLB@G&Rs_`(-;Ekn"@ m>ęफ\"-S%;\Z>$;0CcSE\$i#В& xQۻYCa;8$LA:pi/vlIeR4DѬWPkljh& {[8IL~Hx9<DZ5q7wV@'27n;]\vk)0("Fom5#v V58 IL$j5LA)ö ǝ>j qU6;1Q [?@ǂJ\Eۇ'k;xwd婉5(Οn.,0kl&AU{$x(h%Dψ:iQ#@4BRm:Jt"< N0Slp9 V()Cϙ$8A=Cb&8,j<BIex5}s. ~tA=YXh6H?(t,;B<-Ӕ\=o=gM{,upTT)-;#Sء;(H>tƆ $Koaum,-6uuwRu䮞tR^  8Pj2Oc|;.%ܴdӤЂ$)$GscY!!vߧZU52c m'2ic#"d=JvCA OZbh?,~y2d Mq:BvEC\Qn-v߀ɬZӱ:j@(X;u!w.5}k26t t?X2mZ] 8S8">H0/n;'ߓznA2xObuM4yBs%\Iÿe<){@an.U{] S8%D= 89DX},]Qts_Ʃ`lݎ`:HQ۩ .fdQ7 aݳOo%ku}sk2+;IkI0+϶tPӞki?q"#.@kcĒF˫W`uq:.4$n^NU~]n[FIcF` O쬐YI^= %ܨ9Xv\d5kZ cb#8iPƁ2C@ˮmL+VTu$I p2g@x?1?M5P9G=I$+޲i-}ڻ暲Zd4#+w*`4m:*їmi5?/2t#;eńxp?hOGgԝ::u[XǮҭm% ?,`p:c:Zu:L|:H:?Ihu@2[e j~db'}kyjMw-Q-vhDyO/Zڜq5ڷ@ǁV1h6onD*9~vyG@wRͿ蝠x&JqW@&HUrM-;;;꿔WD#N $0r4sVsc_ y)m8,q,q斖al4zWï!Ѽ6[wT!LCnfښ$77[e>mv~#{k:$uh2owj HάUTc{RY?E= 68p@G}{!OhȽc w{;bnX};A[)> M[^Qܗefc]D~n6渍x >>jDZK$9~oZjn,y/pk5q=_vٳ.3bxW*Z_p+>XzKaldם7wm(k/Q0%9pwoh,SCFݳV~ʴ|OKhʴ|OK ޗyoO}UVV~mLG9"'D ;4LZ[`LJNkl6`j| ab`d"6;+Y$8vCgV$p২n0oaۯxIݯ(tS] T;(Н' 6pOIײ/5EKNA彩!ۡʅns:)R`u'D8pDޓN$7K\8 v3yeA`oa lB7Ou:  ԑawƽLw; lo..RA ߤ&7)E<$561:0S9SXWDB=6;[U)\P`h?6#^R2)XͶۍ㫑5co'}+`W-:h_atOee]̤ʅ19joD}"7y/qy;Kwyj}w4ݨFLJT f#JX]i8 d$]=[di_US1*+KYĬZn*ߧuq bI%`UpX #֟%1)rv()rUbӰN|6QۺK>bu$БJ4R>{Z{x읎u=]A FB+_dpS,3;\5*trM3OxHUy)%MVI#AJn@ ĺ lt%%('MIb@Ax)Ua%nI$9To5G`x٫Y$:vvN ?dlI9L CII$L$)%I$#D4ʈL^I?r@m$IL{^(cTUI$Ajj%ۊ#Z wY$թN^]-% =totऒHg(P-O-'I;"S 5ALTRٟ5 ItDs<R9HHI \S !.II@{rq-ղ=^TϹ6,*lS[K 7$ѡq|BMPӎ7Drʝ}YZVY\{zuuXNߥaz_,Nekuo/gX=~&Omlpo5׎h.qvvٓ]'c=W ofV=]fڂP]Gz4<4W=R:}o\y7Y~o{V:?og׃նf]OSҩ+7ecV`N#[Vۑ<{n%֏{ʱN86@Lɟ̥kC!2Aݸw2wo{{Ho˶$(wq3pYŇ8:bX6ߢTճZmnkyi!n9o};9? #4`熹l5ZXZz#ma /{nGj[1W"I0An&\!Fi T}f̏TqHi~]N] X[.ޱ^}y&_ nTʽg3޴*cqk;UH9N ;\'әsѫi n@7l'hlA9\sbuk}W21lskg[JE9mX 9kmmG+om f=o Uh3=?I4`tOIo@ ˿a/6d8q$C?7%&־lbuV4_NmwzDseB֖u?T>s}0vN~^6cZ3n{3ۿb+U#`dh^72 O!xƻm*G'"n`-tOC^2Ib[[q=V)gkc0wmL҇ձ> 7d8kOoӽzjS}XƷX-nMlT6ަ ?%O;0cCtIv'=Vk$\ 5(7[j8=zlg3>-~b/ɰz{+?:˪6\A 1;[g?4rXƖ_owo,c[Ɯ6>=n?,=먊k%շRr$RelcXΣVK`~̡CU onɗzg{}:'=E;21:]5W@m{u۵gW):ͪuq~}S-tC'U}΁vZNF- :n¼ Y:Px϶M𞚩kSwUw/kZc?7:[YriǺ jL=g:Eӆ}i;[?̳͟UV@p {D!Ĵٓ˝XEZ'(m] G>NFN&yuUKH2I6U6ͻ\3( }U3C ~m$.E-~?B/zͯuyo}7OȨcZ#A(HLWևpN4 'Fyi>iXz^]FƱ.;OCYejmS}[[}-PM=j:$ ıK)oEK6q|0ؓ>*xW\.q0O_MXs-nƿJηsKj.$yɩ5v`+487_l ֳGV̶HrANo/UëSK,ma$c[WY_OƖؗm,Pm \f}D_.^c7OVut`? 8u><3_IUUzGlWnkCf#n8&-7nߟ is^d?GEN}N2 tП[Ul^,0[JWmt=cZөh#hf_b{ ?_WzN5 *֗V^ms8(OV:𙺖_dI߷wES%$[{|V)~ג]m?6,+NISunssZ}*ҼDߧo?G_hCjk?Ui]u4ک n;?BKcsZicj!u;q?Jh'h}?bjܲ,*i="v[Y gg􏵿dd<0Tq?1S= uB%s_lz8{-n=i$V#YC;SmN8K!a>C$ȝ~E7els${uiuޥ`ȱkX~K+? \\K :+_~VU')!l?Dz<{6d;;-ޯkb[֞ c .`#}ՙk=ODB 㾜z-y5@o'Ojt:/~-{Yg_|w6\1w5tDbۍE onmMggKVn;1Y;K3Vk{ 7?7.iśܪY22!jpvV5=Mm/c >6Woia܌3Pu۸9㲯𕪕\jXѧvitlms s_N8YWǭ9ϧW=c[Tz'$-ީ$ qh844 c]?جue];4oEf; xvQ/pdcDoaWs]#6`5?;YpObs>kв?W}5},z#ސ407sF:cbx= ; k`mtkZ֍{tvJ:@+s+8n"|;hwM7R8qb=IzXd~ǩl@kvR-q"5oEiRxUnOZ$4QNP RXWS"۰;qq,sӯz$;f44kZR]\z`XpzP¢]LY4.<~Y.cSX5oKQtUFcKAky.۵݈t54[7 @ZzIrNJ_c=}ZAoOYeVrawK?G>ָ&ɱM绰HVUvLy`~ߩH[9Yul:^ ?)tlƜK8sI4֝*umtBdI->, u  .AL|\ ËoEl+sD;k`HݠLKZ<)`aM@wMU]㑒vE`~U0ϡ:Ic{0[=4TA#J@@sg8"}##D{-pSltYRvH '\Crqp0 rsr\G:m.%MDG%dʋBF(ueMkk >^5˽_U6poE:H(`k7>"ֹ4L"_;&$e?D<|dm.7<-md ?  c]-0uB4n@zbx{LJ|$#ձnae- +NSwNKY6?)Xө+Sǘc|Oog捻L;ĝScvPu{+>% S`cMn;*/~\vV엳QՉ8@I˛V_/ue͕GZ];=p TzL+Q%G+$IRI$I$I$tRI$$JRI$$IKI&N%)$I2t)I$II$$I)I$I$JRI$I$I$I$$I$I)I$tI%)$I$IJI$I$R'LI$I$-W6x$PFpPNhN8)fI&NRH$II$Il5|ʾ`ptMCUST(<(IJ-&QyI/!"H$4AKI$N*RIL$IJI$$L$4$II:RILJLaHO $bE-}#Whą+  x`kn9HS=*trHc*uZw:lѽsdg^4 !SǺð}[~|T4 󪿸m;&JkTpG=ip $xidQ5]H||dq>Ӕy;J;Md"GUKv`X:vs3~!;*6=Ns^㲃n34HxKL?嬜.i:@yY,ӯ:~lk}%Y2"$%kƉ'ײCL6"tN }j|-Xac_|w&w*{ O,blkV@ho]ɀ vY[L><@ܫ$ :^N :h)F Yw?v]mHu N7΀\ˉ6}-mݡ0|(4SF)z*Ƽ[NrCmgP1s}-;wY\eFwʋo O'; ykxL{5Z Df|{^LJu5Ӻ) RNS)5hLhILOke"yH L)qQQ"1 xAMRxV:'IT04Im{8IL']GPúJQB?Cܣ#>i?D@_a#_;LOqA()Ir4>*g&ƇBij甀1䊗 3*-)L? ?ה'JWCYY3>J9{5*O{N bI*C[uTݖ=|zϗe[i2rD{,;.:ݭ(VwOt`mב4Gm!̢J!-Sʉ)˜[Pe`Xq㰁?YdwO0ݼtʋAKnW s癉Pmb$d 4uW@JTbyRDuEŶ&9At%!}Ӧh/o)1~pZ%NbAq0ѩ *.,= Qҝ]؎q["`(*΄$w!3(膴LXg[0 ,Rd{tN8ZdC5 i%.S5׈>hT=txWO=X0IDL\SۣO~ʻ24h 7(¶e@e]䃯))dQ$'RƗ5'wA'_g=@}&uRRxp5 <'t" XlyԜqa#˟' HrPH_%}XDV=AĞu5;xvÁ#i&[N/֞y$k{du hK8dTōq8O ~8iyPK47Ƨ rH>_IKqKvSmc#FI:O9C2TGdg-xIKSj5SVv€CZrYd@h2#Ok5b>*Qw8pyR;Gk9~;OF"6O+f&5G:M2L7lݿDi t{"2^ {Em#S}?zKogn%;_3Cs5:ʪCtdxՐ<~CY!ENy.4䤔L2S=\@Ah2DH; ѡ̧K&Hin!$XD&i~I?zɸh+is8jYUO6s]2M-3=LJ(QXë zuHSTaÝ9"eDu˭g5Dԟ[&]?$Zwl|Ɛ@?7"8V'AXof]bL)G儱OC!ԐNtRsZ7?*pIDȨ'ptv76Xb2@3(sLZO烙Yt-}"8B/{oG~TFix c]Ef${و`:tH :ᮄjv=QvK.07Ekb74 ~_BƗhg6xUGI%0iSQ;~R[w9 okUk@wR#T{mjJ tSۧ]x9-?EǶd׏~fa̟I"d F9HcyBD<.#iD9NpZ} 8搏0E.>e KPԪn;I~r I]k:ςNo;#c=׶ q-n,%>ySQȴ`IRHI({ C abk!Ը2XxwyקZ W2Grm8vU 0(!ưGE7~ &HmwR( ÏBvN얗dH?F[Tk0(q;P᫟t .2Aá3ՃOIW k8Yϕ؛w6?  - Z+~ʴ|OKX_TZ>'x9'',pUY1HHLoI%'JKRS$ܤb%#r-쒔 I 8 D$JRJ!$&⒖Ne-ԕm:ZL8;E kCT7O~A!!7$N,Sy6eAnj l6JJdNЈhB]svN}ڢ6 R`x чoȄGIw^t+_ KC>Amv@}7wM F*q)FuS߃Rf;pr/꒘\Nz;TXFCO"Z{pP Ds;Kh /Q|YP|kRRKCy>X=1:'didb ۻ}D5"4OS2!%&kCF )a cM{\en@QkaS\HtAA5m.Nv<IQl|sQA{*K5\S|{%r6Kg`=K{诰@TpI/2|UQ/2AVcH$`6u,vD[ી^SYef3uRMk6a SpY0=%ܘI]pSwwpi:T.n4Y$)X5R-@X팈cw`}&o^9q ;]:yq @"'ܤIY=6䖵.=X_YkFci5ŏCgcK.!cG a3w~b|3&d52L)E?D:~1Ƒ-5O!^cZ =ֺ5ĎP97GPu^ vxg3g=%5$nyBY} ݾ#&ڱcs2,ddC&s1NwK0uNMmmvTS;okM0hmZݱnH{@lG3#4Y hv'_v( }X>;Ucx-8?`18A2HoԉuKWcU-%ͬ5nR XtP}ASMhgj97ay'󝹭/I nsZo{^OS76 =kG?zd^X%y =94 w`3z94h)Xʯ{M9U*ga`Ջ{^_u9X}=z-eݭOc+ֳloS?sEԳo2f5+ٱ۳&YO3L6/ޅHV֗X \KW6mCvͬw6aTr:v1s]o}ye{w<Ϲg*Et\̇ے11m ^cCcq_c.t:~NKXq;r+ :Nn?U1Jn#py-/$ٶ=kӉQX`;ѻu>}~*}umk]=?͟nnFwjSc"k^k=[m/Ԣ̫Z.D4NU*ԒH$G~84ti6{}/7p?G-mK7KƲq.{}WЯ,n1^NIIKXǨ7z4c'o+/c3fnԲ5M~6dѵ 6ɀ&cà;~omNڪ`'QřRs+åFsl7Fٳz ~MC8d3dGIY_}[8ݑkI#*3b8_?< -6L鹣u,/tm\AݯՌUy5jݍQ-e ;ceYѭ~ݯ{K[Q 8w-*l̴)`;CZ;vetgBvvS@m Huoj=d`x]Un K&7X1mpK'+VTk)۹jD}/YFӛpyжvsvDޗa{w[VgWqj s`nc?_؟ 6e?_eZoɮcqlḨn"9Y)Zև8$[lRq.}8Ӯ XGwE}:AŧUUY=Wmhos/&B,WS\n7~k-?OѦՎ7_ 1>J#g>ͤY-{/6k~eKiR,߳M }}YWtΨʱ7Z,hta>c>UN\z(sHV sl`t\0'c^ZN]EcY@;Wppޣ AUb.o KaFKiUwN{o{@so,o=}{-sk=n#uVڋm~>Kgc?OQSαN-õhka?ɭO*"7s.y2y}X9!M`7v0[}K4sOo"eqdh'M*^n_99 o!4 vV] ~zW՚Zgi?JX+_s6}1K?ms骝r{li0k>~g[ELLW][Q:?*˜Fy%L~EMRn[CCMQoYFe^]l;ָhq_Ie;! cd6}O[fdc+uXsDk߫fPK)aiV*w.qJk`=p;q'ls ()1s-͸Xj`Gb=Kΰ@c*ilcvkSfe9YpswEM^vǬMlh iǵϣO搅NϹv:6-I3P.'F@ʴqvۖ;M A6^?6W_۽sk=?m;…n-QKY/goht:{X.},vc@4zUO.w1OtAsG?*.4X9>)P83yX1Yaop?%edoqk| jtEnAf_cl{m=Y~լ+*]Kw49tߥXcb59֒Caݱ̳"t}&$H~-k=ާDL6ӨԍC{k6XtMzm$E-eYU"l;pфU#ɾ:GZM9;_Ák_+98˳eֹvWGngOڥѲuS*6{stU p&ӧ*9_oKmUz^K%%;vY>\.h0ϏچOvm#IK\l} Mw}py;G{6kl1ecKˋm}-]xTӉs5-S߱[uQOUrK64{?a都Bϯko`n;wG򿬇|ոNxڻ֞eyXs*I%cw;skGb6k[/<g2]Y)!/g(5]Z?☕/-ƈ}j[[k#@5ID Hlu->ڄ@.s:7IHnZZY$ 捻7l?6,οM AqoM5k`)o6e-:=SG;8Rtt9ֻ`~Q]kq$Uۙ pH_AE辳2>U?,ma53scXֱֵO>oO:C/mnm[Fml>-*`nԉulwvD{KɏymMK'ĥOo$oVګn؟R{[ղ)=IKidsIic2U%h~o.]KZa69~VIe .ءki*Y e@'Tx/iI ڹSuScz}3;`-{_=/"[ _k]wޛg*2olo6dnET{+9?{wնA*G'B5䲗{\}0p B:8Z0_?!swo[s6@?VCV/ίf@A]G.:.;y7zuiۉ1G7+8c,˼ VY ;rg,ׄͫ`t4~UX X5~{}he_>Sֹ0.3\n$Ą!qp=ޣ9.#Y?D/5U?XsǵA _^0|h} ;v(YQžeMpkLXj>;G%A: mp#@;$6'e|NOS(,HNrCU}'-uޫ&7ي@܏*V5 UVt|s>)Ts`xT0nq>@GrK)_#' T]w'XE{Np'Rzܨ͵NkOmл9VÉ>?P\GQ1.Fɱ5*:A]0̰ؓ(GDXn:_d8)n J3NʇyUZ5Lxg8>}շ<Rr]5jٍ]6aTxi&awK=M6oy}ދ wNp@mt籠^LKYCn.%e~ߡU~Q2lk}Rc7zI:d%L2I$JRI$I$I$I$$I$I)I$dI%.I$S'LI$:dI$I%.I&I$RI$I$I$I%)$I$IJI$I$I:I$I$I$$I$I)II$IJI$QuiT g$TȌ+% CH<2+. t DQ}"ٔ2)tIE:d)I$̃W"5Uzec[&STK(.GQI$)&I$I$$RI$I$I-R%$ܦdPI$IIJI$u )J#DWP:&~I`rlY _%.?DnX@р~*46=J8Ytq|Zg:Jl 1lah.@iC0O?U4<,r&U<=?I׺ګCtAG`nn[[)a{VU56I,뺭8:Ghs?8I䫗LeZڑ?+>ׄqq=RJ&uc]\ms_TvLb&KDH'&UW?Ҳ GWӲbFPj IC>'թF8 6^(2W rm5 Dq1@:Dyg4wRk=+ VAki'CɡZ@%w'quG3 JU?2Kݰw)DO`{'7n0T$}hOgPmn8P@PU{qmMF^ԯf2yW1bed`8#cnkk@A17 zMMkѱ+]JՖ2L1l0ObcG/w:~i+^`Bf[;..-Zn;jA&|GOS9F`t:(ƜNM5Do,FQhRiԑIX%;D)~TˆO&|PRǕT$j'ޜ JXH(IJIzm So:$O:"HA߇}g␏%?<椥 ?NOƝHp%(4N4ӏ??ib~_Iܦ#pN4KJMiO )gGNtkyOmT|?ʑ hyAJ1o&kLq2p?(EK''M&)<&,G%BaNQl<-p@})K;LG) Ru]H(4 @B5j GšPeVHC6*Ƨ8{KI=mqq hRͰ8Hy'J$($wR%$NE͟L?'%=p yC@_gc4ĪC >e$i48y2թHA1TáGɨj -`(XI:˜u{[TN{ORLA:(?4۠!1ginCmFLKݵ“|"'߲r5:vAm~mI>CL)ŀhSj`;$IJPTH2Cq%F;x!۽KDkp*0[C~=ߜRl/r I7Obn}*eQ7GmpէO)5p(Ӭ"ףX;k@H2paՄ20;~{} x )mwk[={?)4#Ĩ!~d nj#wzMOp&;=GxV]c)o+c;)& 4d7%N[h!ȩ-F3JG.Yj5*pI|"Ve{9s;bs` "l$wQ=K SG&ISFkDy!2t%KΤGUӜYTj [ԙR; X~M{;1TrǣgEIs]5kԝQlWY/8px#4RֻӁcN0F=֐d .opFػ!K#C9;5G"6 A=ӴwFd˷ix!0ֈHO űI,p[^ :"DװB)1#̑o6U7RU̓}ڒHQ"Bet'QQr6Gk%FjfzNl{Ab S[ZݭsA6@:]N`խ$[X\~A9Cs`! A?U+m?в׹q=PܡYD04JUm G?1cv5צ.nU{A]\hW1\4`i73p r׏?5?ݫ@}F춺6~j8cEvaXf Om?}J+vݦ>'-U뭭FaQAsKkH7ݮr&I;L(S]{s+ul905>Ӷx{ZOЯ,p<+ĒR+uꍙM{*P\A"Tob}ҕDX!Zk ۤqn#NO,~ [Oβu ]\Vun)5mw۵K:|݂\Y؏Sp>J+]& %"FY@{ҧUsvZupHEnsʥcv?HDw mo:5xVZ$kvL`ٺ:'07%NȗLVx>lDA~xsd=i+tHDkzHUs(jhn3.it1I VZJv!gX5?UAw+Ñw^\O1.V)&7 H[a ,@zSWM8*h@'BˎHkʇ^ӟn7[.׸,@(e4[؃`% ^ܦlT/k^~cլ lf8V{ ?9X",@kaoJW\B#sh̿GWe{dco-zc_OnMl/~ʴ|OK GU^8O-OX?/*ЬɉDINGLo?d `Z' x'IrH|#D񬤥 R0M @vTqh!w<[)*JSz_u'@%cn.~{UL2]'!JvId27 ܢ-c[Ml3?QZ`g JH3h)@\e%2$S# H1tLP@x 6T}ZBI$M~b6]+gc6ڬ;VVO iÂt^`DA豎t0Dr5Re)t&$x@5<8OJ?C NV$i ﳌrD~HilƊswt\+GP2IԭHh3Q꿀DmrH(-0T$ARo}@BFL$4N\G N׆ TW] 0p9I@n1ֆje$mFKI?TC{!rVabe5*C7;%?ѻD{c ;ѻF5=ҳv0^RO_ܔʝ ,v2SC\R{GOܤvDaoQ_&3nߙLnn)'C ^g+O`V4aA쒑=5zjuLx y$wD{E!s}IDeeӡ.o-oIl#c.ghܪ40>4nE(P_ǝc\k`}u7zDz$QKF5䜁S?⅏rmq0ڴA) (>=v (85; >i#e qy*ovtg9>;s+I$RsEM+|'B֘:T #ڊ|T5I `qOB!9guI+JIBu;07fSs(YР%I ]{!VcNl0I[jN%G-'Gd\C(٥-I]$L<D;"I$0%$$JO1S)J%I$RNc HRI$&QcSalLIvI$^QӺ5TR4Rd铗vD%Ȯv!␤$ѺS7g?>:@ZSHɜ4HI+JqPJS$NДȄRĦT7 vFmat:kGsgMIuM/I7sf[д0).9w!vd;ǂ& )1 s4+hz_Ag3ա{lv[Iw3,6cM0: NPxmxO*V`.2$IV +\ <]=5=5쨝Ķu"-Nvߣ,!à[~  ?XP}μl`ei{}r6X$Ƒ>$ڟ[QpqQ)f ~-U{~~}U1K/WRlv۴nc=`ˠ*q 2TX-;v0˝'$2e VKIBV@0[nC2õKC?sU-uoT6Cnwy&K[~+ c]ǃ5V0Y-`FZ l?PSʘ%5:=?m -7cT 5xun;,Z6qi58F]Ƌ23.[?Պε#~??1X8~UNG)w\h}?wEs>WTcZWV~K% >z=Vљ̋׼oߡz GRoή  C􌢿P.Ƃ@c61?8v/]ΜVĻk'[}\shcfļJlblsl&Cãv?L=H]D'lF3 6~\hcwW15Ls"o:rkF|f_)?9kZiw]P-:b aIߝ5o:XǏrSz-N^x/ w#Ks5c >l".v;>{=~b11o{ݣ=k^_7Džk_EU9hoј͟۱LxsMj܃![h'ѨZ=WXy7X.kMN`.sG'uS29ç.!k78 ۇK}zl w],uUfՑ}5[]U*6kKk`K2ShuX=a56Xjkdab\a]0 Nreu mmfkY[6{g PNz˯>Wt\[[F;rc t'mn'l?{5WzQ<7p:Ӯ%7m=~+I$1u?kPh_a.w?K_~Jeԛ^G6?qoɻ.+ǡ.;ݕ;?3oJmZ30vKsG]6dm ]6U+Z,%ˏK[M l4:Q-m6#*NOv}J[݉X6wlgrߦWmb^ĖzX[m\Vu8{'_Y߫;Rlq`p͟o/ gUd@s$w߹y}1{!Rà|VsS]i;ƭhF}vƦmj^1ٗ&̠MT赎};.?3즐cFNo*[^9ƶF;?;Lmdknkae -.{wHji2Og~*ܳ_ci.n-#W=45Dtϳװmk3RkgM1"tSF5TӰK;}~{nKر+cz̦5n6=?ZnKI>g#ۚp?5G3OV0ġW&\wZ&;,.I4hehb0ƃgT;$ ^cٷ uo9]=dWV-c+el߿"UR=[uyk?WYZͲD'{o#1Juhryvfk'nkL{mE`n# ];:4z+?EeҺ&OPo2j$?H~,GW'޶`tZ7Q.)Wo _hԼ=ĵ{]W4,k+C[0?QhaL ? n䦶CA 7Hƻ#"ZYqn㵿fcwOIQH}H{ 2?47'񰰫.԰8{[m?nɼCg%qm:NkA_Bg9 GޏH ??IKeI7 uCMgW}im/e ۱読O{_,Yг=g3{۶ &?goޅߴ䶭Mli9+\,;*h!؉y^Lv?{PRCv()]6"O M PNU<4K5MgйV0K[l10o'uzVE+]fos_u sK96~g'h n?FE?Z?Z?'PmonN=&)02N_h+ͣp]ikɫf9^J7M9q w{?o}\eQޗNKʳmVGUzfuY\jEi kBN,45]#U= [#b bO9G+S_u{+ۃ\nYXcmūX̷[Zpk }luP8ɦlO >5w77JCLc"+[Nn=:@?G3-pmsre sst'Ix'mOF#&{?m^_较?L.̳}n_a'_} s36Q9p 4~%gF¤t:kIc[Z'sK?5r[+uEӦ}(wFs르mapw;I;v9Gޡ+ƩɎ8IN^fS+-svYX4ݟf]6]Y 5_Z,k+uc8Oѣg#)^꺦U9Rm@7v;O~i1yLCA#ٺugoM^?. {RT=_n>E=]=5<clޞޙ^k$CO'"OS*s{Z}C?{r;[;yA3Xy^wgtTV[=jf;&UzΠ\A;;=֬G)5=.u^H\A':چ=Cq;=7k\ r]c!ߘѷoiգEo- }#0| '-K5ͥu2NֲOϢkgV6͖YK`~b)^ m/6IvYc}ugi`uc\{gլem2֘ܮ$?QeX;pory+?Dw)w 2mim> fmsv։ڗV'W:`')u#WO`~@qn c9mkFxvU:M kd.'URht|WK.Fݟ]YY"^_ZW-?_uůe4jv_cEsisk֛tųvh֍QiN؏k'q5 .kY(:+qI,nѿe>J~F;ρ/-uUq:&DQ73w3 A}Gl' z.<cVoxO Il 7$/T},.!n?Ϧ@阌c}[7ߢLcLfP6!.N8O>}Qhp"A⃏K[]fc[]X:n5 5tiD]"kd fwS?3h>UVՋ$ͳݧXYvӔC=6{&}dM,%0:{G$ȢQYkβd+Ʀ)_M>M L:+Wv1D{mUc-ѭ 6?;cln6eͅݳ}k=hk=U/LfS"'挀$,۶u'h~gim]~6F/O) ^ DڛgGu. hDlJZ6P?]cݣf#I;I16BSG]aBfX8Xw\[?IWgAȵ7@S(c E ݤDZ2tFs)TG*68ɳR¶͂0]p#?F=ז˵ѻ3pH=;cKv AAՑo`{K$~{GGU Mm{V+kߝ̕X7t dXIytOP0rT3`@8TRZ4hYh}#;i:+ Qri5 o|"=͒9*<\I=x]"UZ͑Qk>dIӹaTֱ. Ǯ4ޱPɟ*x.Ӏ"Ij\໼+=ܸi؄|׌h?H.ʶV;[K&͐*ٙ ƤǍOMN\ >M̔צܲ7|ƱzO5hP1+%{}˶4󙴶H#E dmw.BI% 7f $: RdI$RI$I$I$IJI$I$RI$'LI2t')RI$'L2tI$I2I$$I$I)I$I$JRI$I$I$2tI$I%)$I$IJI$I$R'LI$I$*⩜D")6p)D%NnMC4IZ{!!Z ywRL["@pC}DG ]$N?jUͭCW#b9S COpM(zpMp%>›kR( 4H$AH1ܠJELi)$RmJR0R!(H%/)JGLHM' RB$q4&R )J\wr'Ki %.S&.*.UjBS]}đ*J 5܍yc kBiBp]|{]W/5t_#l7hQskwa3m&fuDQsrrgNs\A]p<i`Op;i읷S$LRF'-6~h^ȂX7Gr|b>_N8vif]my(ֻVinڽQn{)zvCCJ>F!oּ +UIS5;,3${:Yz(yiT"541qzC t>=Ӵy[B(9u:ufp ]x;٘:08Ӥ@<WQWX=ceeE.,sැ9p]`v1(ޛkX ܆e>cy3=tTi+ǩkFt o ,Ommx(Ez]mhl(tQr8hVgMpyi2\I_.'?ѩޝ\z/*2=pTkmmրྨczaGF!?5r LSEhLk"JH(%e%6<)ȒV<_ܜ52)y?T ;C&|?~i)_ilI)LߕGvvT3ʔ>IƦ;?)#x.<`n'eD:}N?Ʃȏ4~ )(`)5Pc>ސ>xT@<|CG>itIL93䒙:BNt<Q߸:Nli& .fo9<x4y-qz֢SC<*XKS|JkÑ%!AoOQ-UyJAHNǔ'LBY2-P}>H% W ‰f9N&5I-BxliAC;>8(yHt)p,ƒaӎZƂCw8$G}IH$iNLrR<C:%ElX̃Lq 5呫H9N,!Kp"GMƷh?)zֵ~y׈ʭ)gV$*$EN0q'@cM;O!Z7{Md%72Nc KD3E1hk6Z%'?^d$ m$>ihL|:Wqy&Oֶw>mDyLaI~J\0Dh_BϷNò ˳`Aܙa>z e?g%&qk~E"I }?5IKmAAfK8I[lɕ2'mvf7Rs'ZA;;gC4we[K -'IVR#\O!'|9ֽ\uM'/*y; V}$q9%jkG g^H^bmd8XG=})pg N@9 xӹISAwјqY.E5S<&rdA}0M~5ʱIaȬꓩcqVkNSw:|K>L}ʽvTOM~^ ڬ`4㼙?PXvA#iJŅ2G}?꾊L vA k1,t-H8:gNq |5.۠᣺cT7p5;9.:ԕƩIwq\t$G^T}@?DLq%Gp[?[؁lUA/q)*֪>5Oy $?DmuǙ׷~TedV[L#?ue݂Ni!|b/43\-fτI$5?juB esc5J>4'l^ #U뵲@LhաtjZd]ڢ8OW]Onf;.EhcDm21°IYH5kf3aGn4ƦU-x#I(;e@O"Yp?'ZF}ӘDl7uN'A-Wgq#VÛV-~ ;64d4  rىxoIp:!θ5/WEō:8HU7w~;Ń`4{o(5\8J6MnAh>Au 5}tEqҋ7?p<φ5a5u[+; 4++:_`bd*3v kGQi;j^;4LGt.5=LJMεۏrS $ƍsks=^ecZ\D߲Ц?!R*1[(IzX?Qu[`:_7A}8/Vۙa6d ?dS5L'ƬRb~pgOD dO~13[#}):0}]ڪE OOƪـ#.a~r{2tvB]gˆ!@4FӡJC,^N1֭$U͎>Oq꥝A <)'D}.NAkq:_MDQ`iN%VnUOi}Dyh5Fxs7k2XiK\#j8W .}mK'[z[24^*Ԯ=VDWM89YCeo7B=F.c `ﮅ~ʴ|OK>ʴ|OKԧz_ >eEX+JK ~$$RHZvJIJI)I"rD%%(&JuJS_}t3u o6՝1o;9$D4'eyۏXh!"cH68Iq緂"daR)E I$S4S NJI$iRHR{7V0k3*\pDq6L] GnL k,xwCpzr mWm ;&] w@FO(Ulk*Apg?TzSxt**TRAݮjdBVh%N@BdhN.;vi>w6C}X$Urz=gW5O Q-##SqlnDn<ƫ6E ]R"@쀼ho;+Gnͻ?IlYu\jǡm,ū&wIv8k_,α(4鰀#vY qn Ï?]u&{Y7ژKϹ?!}lhȟn4M6lsFѫ`klVUgV 6㵥6Gmhm#n"73vo}_J=?+i Ktn%ߟ?ѧcsCDvѻ)9ȵ3cX &_b#[imUO5|:-Yus:ڽ3qAtk4;}?2imPw@%'Msճ"[乣eSP#vYQhkh?B.Zvs6"5D$}-h.}"yt_-Kkzd1M Sl>MCheޕ3 GA;v3>Y=aSU_cLe[K*5CX'q b ku?lXAv؆ݯYr)5}'ǽWfP{ /me7b_NRuu/{IvʿYg,uc\ws?_ekNcr69sia"C+D??%1ꥷ7~;Fg>ѮMnsx?Pk.g8߲}?whE_?\,ChA-$ =OeuO"=~y͛\P~fEu.]s [=:5mKԟAc1 o}+;}kgՠzNU\7pSj[a:mc+a6XyWfCmH716,oL 84uzQ=m׿Ѩf̧17"XkwEFs>dG"3.qѣO{֐R"ݽĚ>{?BϣE^~f^̬ h_n;mntѪ7Aȴnck%ޥK+',BM =o}ѳ_a=Ē@_㯴IUz墏Fs;v0P, ?!F+srǭkk-..%g-,z3ߐs+f}Qo$}wjH?Գ%_i !~hǭ`Vtݱ.z;#48'_o}{lv_=6LJ@IktQ(:dQ|S}/W ƣYhZZ 8#;EtK;~+8h6-64;G3}ѩϫQdk/GGE]30lm8\CMŧW>+p ki\mn7Y6Y5OOOkՠCZ>ƥ~;ĸg+"\4npk_]A}GWuo)WK_F[-"!XXߣCizwN,^ѱn?3PsLqw0ۺ&`{34kOw99@T #WVT5e[sl؟&t|SVw}Zf7Qs1}Yh#u"61=3\);MUm}l{=O՟TϠ7GnQ= @Uۚ}l5C[[]uw)4GM̻~w:=kdQ\:Ol鬼kH?Mv=b'Z~}gkw.|J@On(Ms;;{[=[\d_5*pͭpt~!$%kI'BƴY̌ƁPg: j3pk.|Y?,?CqTlmdfϥ]UxpX|EBdhtq@ =5F<~p?% Zo4|/蔺\;n3 VQܼlԉ{o絏iQY>q'[̽Ytp kg-ϵ;+^YEsaѬ@nb-sw5GSun$i'_渉ՏI[a]ek5[sN_k,n nx-gZf}-kZmp{Zև;kC??Xf+misISS fݬ7OƁTvWNV}[u;":͕X-7xGv_em,95h >{==95}cc1XcSsvϣu#u{ \vL.GQsb?O^?zoɮFje]4CAJ+~}_\Oҏn3YuXvŠE9qctI,cI5HvsTKakuɪ u.Z4'د@D6dDA]!R+9,kXkk[Rof;K;uo;o ƌNLJ9>~u#sݹx ʫR1QqeǰUm3%p"~ ^ Aܫ1ޥn y73a mjk9>i3/Me59`"tYYXsfZ݁{)i܊χtMm'M~ⱐKkXVMNmDlzu~?E34KlK=WlΥA{KC0ETY{tO6  (CwS*sI..)ihw GݯsKa+nk]m'S1ꄲN;Sd)鶶{7o);)Hky1ƿK)j_s:RDELb@0]߼ޠish$ˡ?(2ﳴۤo=! N;~?JqM\\!ҝ6 k)o;F)Eۉ&Y ,AGX6Giz8d4n-suIFlkd.%U!gJn;$])6+׺ͬ*[iʹtJ^ 6L@}8,mAZMFߑvIP^G;Z"5)KUG8.@CZoZ춙ߣA,m-:A$Q(hh:?";,uUjˏ(44 oHT$u>Oie\+iwa*]3v)|"F{0z` "\Dx ,5 vyS"Ѡݏ 4{PRxF=Fm*BEkuB,P |*Ay:p^H:1}K 4V㊘^7SD4j6n-h~L%A)cͶoR5;lvE64ēUT<{_UMm-2"?{*cqJz_/u+k.`@:r#kߕs1 ~ܽ{\%?1ڴI$KI$IR'LI$I$I$$IL%,I$I)I$IIJN:II&L$I2I&IKI'LJRI$I$I$I$$I'LJRI$2IRI$I%)$I$IJL2I$HRI$I$TI$ u @JlEI*n2eFIfI&-O &IJI$k'e@+RI%Q{DAo!eavVb{iGknBԷW W)VU0J {BZ { N~˝Ps- LvB)4=S6B緲$k "Rx*8Ew F< Z'1SL;o FmŒ{BpHkhi- 7QCWs~^: V}"R8=ʰvbz8ը繂L"~"Qv+HVW]A-&A1TgTv>rFUy *gWAtYT}` qhgbXG쪇k+ IvG}=$.4hH=2Bz)F5mзpWi{Xݍal!y#]"6$},!5GC%$ 6wC vfPnpF tz&.vOꅜZ[-90Pr 'aaR'!|z[m"9Sdky>Ht xk@߀\0?"-) yS;Wa^o.~kzTl5hlz|*EJaBOaI=VJ O.Nv\̩@? X, C\?t4~bcT2uqi eVd_PStK҈56<#~Q3)1I2i^aJ>Q:|{)(%GE9L|TR:גq0#D7$tR੶ O\RHϗJb‹~ād=TL9९ !Ӎ#ƞ)$ȤۅPRi:(NkO|$1&G>j.05j2R DxAJYmJLǂb~'3ks:jSG#HIڙ |>gSĦ $c9"yG:'t[!kȒ|x]vO!Y1~TM fIdpT h'MDGwII|7&<_o W*W]/Kyh (`v"DȓƫhoqϙwJ%cqԓ >yiQrc!S O oIJ}C'Mh?c |Rx X) ! Reϳ$*?6Gb?MIZ)>i]u,;0lq @a-Ż]&@<I}y$}u0;;#kwmt|?M4 G))IB5$jgk|?PvD@`$4i?I+U:9ÔgRrd-}GA7ZNl;|?M$߻]%J~O4=ۮG@wE4'_5jԃMD44Pi37gv?0/u7]kit4T->)nZLܫOh u{*ή`pBj᎞{vU4`- pΨQ6N`}'D Hb1phYv(mU 'A~z*8 O?թ5qCG*q}OHHR*;kOaѝc:3*B5L]($xqp誹5F^XAGD[Oэ?¢lgOi93^Gdk#և1`pqcW<ΟRh\ IV:1m! ʘhP7~1u@*KV1f/ !^G i_䒎"ԋX| )1ݏ>iGoTKup[ZM{li~T75/$$R!wM|cLѣ@F@A?٪&[QK _1U"8F`oITO?Lj?Eܘg54ߢ&f$cx 1:(#na]IuFa\ NƖ`hu^ tB;85{xas`(G.lw; uD\HZNpaLXunӸu@ͥ{p$_?{jA<qi~ %tHwqѣN$wR? _YJ#ܟd;yk46 K,۩~)l$Þu^YZpãQjS]pqCG#]̫ $$W(z-;@- R۫Is#ZgBnmrH}TZ,RagsC-{|XH. {Y[/QNAXv7@.vpFWDviQM춱]5CLnTuݳ^"p.;1]~oݎh;]Ѓ쬜vn5 >(݌ x 6ݒ&;J@m6 =hT}Wc֛+qhGFm\Z]0Zp{YA.vjV?EdoE/W I. ='*mŻ[=Z[55w׏mdS$jrD e3YciӱA%7u`m -h:q?WȥZ ;,6oL5'!X<yƉEUW[k{?::G6G!NȿYiqy#dMƃ:iR[ ]ʮǺ ;}?k[f{-[,nZp6v@7*7vVWOQa)JSjeyf"y[̱!'bGMیh-$f{{72>g9zoIq__y߯GKsXd ~^dG_H`{oy<>\[,^t;=~ʴ|OKA:?RqpW_UUaYU'HAPДR*RI$7d- Y"2L`ur2nL7AXG?8YWw"œ VLFTKo(QWj*]~ $5*%&.SHv䪌0c#37>cEq_4@<1DtJCĶHLl#b:oߑ(4ȝ (GmDHZ|3}C%pGaZe&s2Pxc]H¢ãU g? FOJgG-|R * {S~# Ly(cxKI}߂ij*#OM"Uѳ:-8^怫 wkgTB}l-{FuY]ַ' #UkY^uUF$ԑiTj&t:8oFM$l \]:}rŧEzf<2^n1`N iB M }uDdhufױI\#m~>JAN(i{)9:ʎG :~ ltS=ny(|u"== $W<=PLG)S@cR8D`!Otռ0i !x]HMӺA+o䢇5OwAmr}6d >h2.Q5:i Rq'RP+!\\8xJfyLfG ^l2Sc]YVtl`rR44p ׹Ixk cQH YhǦ9PipyV^7W7SAIүM J`}A)n*~\tk?QϙI,->HaޣV\f5<|,qd) pE[:I(j ӿ* zz %$)$U0!$RGfb'IIDjQZ;$IǷ]h%I8I^*I$Zy %Fe%$IO S%EUIJI$ ߫BNBDSऒI3F8uI+'I$lnDߚ.J2tB%@4IQc7iaBVHS2 g;+I By9P%1!{ Tlwe6"DDSch4Yf*h$n#Awo(/3i毓:n{\;4Av~!NI3̱w`KLV9~2kӴ֓SX`QC2]V.;vmjyn5N-iXMcIEu4]ϚK|JCq w4֫m;@?uCܲjCOkm&l*P6>N{~!܂Hc@tJd|Zv薴@HWTXlx)+dW^ [Xiv4nm"li&}?MbZw8OMkKqLt-=x*w]3@aV:KއQQ[L[k6~؅{CXH։Y1qq+۸~M+WuZX\'e?󶾶~PiŠ~sA{Z^KKqg'z?s8o+mmIJ:ڙneoX qV3[CYS*4X4k!FU]Thar]"|ZV[F-~5Uu4y#ǻhmv9}^\iԍݿ+C"KA=utr3ۑk/' p립I*eY]%Tko鹏{~1(~;g}+s⍢'FfR_X[ ƫX۞5>;j{@Ip4Up&[_C`Jmtmo`;5VkUa ߢwT]֏ǦyN;"V럥Y9ycC 7?j!~MF捦87މMhiw64WE'}=#P}uR^?:E`\k]R;gSW-}Zw~z§.oT&) kYl? 5.+>>4]=!0~걋EUA|L?damNF;I_,7z_DG.'{:6mn[sWWYY=1`ͫvĖf]{Ze>FU;ԇm^?Fk\~L?pn]щLb-pi]ّlIsV1-_;$h4-HGi~G ݳh/G~w:~9t9۫c6n&uLt^J͇]?Y=4V17i2I~b;%$7s'i?6?] OǁOI=Y`d;Cgh ;x~V?Yv0^ $-W?t. `vo3=Vݑh׻M+m?ك-~k[mfۛ^ p9@y.jezLHkG~u1K)Uw]{;\^g/EebtTv7hj^߳eF)yk[08W?-?TW]x4PO Wbap!l;v'P;}dWX Yg;M~eމgX=qs[ݍ_[7Aeu;M'k[~s:vnSʹ\ 7V{v;-}?Ztct[]['zU2fƗWr^·I_b5ڶ@?=K"`HiAh߅juCkw&lFsF=2ַM4[?_Y[lǧG@lvz.gg79ߦf si.l߷Bȩf [5,lE8ѤrIm`G? 7YyGZum܊:FC\ϱӷWDlnbMƨ75Ÿ.^۾Sg/)6Yy>Vڟ˽_amHFG&_ݟ4Ԭv.!kI{Ce[jXㆸhԸK4l^Rw45ʍۓ_=\ >nE}W6[jl?N7Գɨ^A Yw߻>v^gVJƱ5ŵӱgNnDVV?1tUشnh֑VgoO51~tO][kű[(\kݷv۪_kc_nӼ XIz.;պXUOLuTz԰A$= mY-3Mk:xUi;m^?7v'lϮufwcofݟCZKׂو.;6=czU̪zrm lGgV΃杖da:E: g#6@n88?{j.w9\N CyOc{7_>N $yOe_[Ul`cXѷ` ;EӷfnsHO~lm{_V\`; l[7 ]D: k %}Wt#g֍=l1TYEKsy3+?W]Vܞ2Gq0_t`^Hks]A?k/u6C[w1{%s.g)}ᕴǺwwأhet6OG- Ydo:UaP=*O~qKgѳIeU\7X}?FןmN`w9G Z>W.;khGge^Xu1g򕊏X > $T~io06\cq1{?ָcSifUs0%a>73C7~k70~־qm l{l%>>=3~_ a&7m{?\l=Ohyp#W>u9{N赿WjkiӰ~mGs5-5.:y2%辳f2ւOX>,l9{ͿKҲG[zm. ?Z}?*5_PK >ƖݳՔly:啎INȩd7TkJlIszWi=ti9α~jF~PmC}̬F*HЯ.w?oSxY.5b;i f}E[;W,i=PlDi-cZ~PMRqt΍ӏnSuwuON([&Nk+_6,%!gԯއѨ#5m1s_^Sog z&6cl:p<\['ʯK6}oZύCt*+7B>-LkUY 6>UrU]+:ZH \X:VlvtwnFA8ދ6kG~=ΠV4`+,cqq_Z"?d>:PcjA?|Hu_AG5AeِԬkeO #Sc./k^eoVfl5 &lEua, κq*I=uQ/qsnH(5:8aּ688mNn%y95+Lo_kƀF"GWՏFv2\|"?CnFΚ7l$Si_\Xt2ZgPul!!<X~b.)w{CcDՊ:.S=Uvh=z+yCD Vh| c@">(.Z؀7GI[=,elɀ.ٳ},Psc}s)w Bxځ {7w~0k[yԧ|΃OO7z]Xm5Z>v67=j@0̫NDw iv?H+7WgZK̍d942;+X §uεޝ~OQkkúGCvrd8)0d%nr}Xt*-A?+>kr~;uH;5U7qsadvVqt.=گT-&._^SmȒ&'ScK\~74hKMt!ʌXִxr>*-vMߔ^ 3qw s.9'Y❴Oa 72&?KeNQۨRADH˨;COҍUw0\5xhp>2`OGfmG|4|ar`*Vʿٔ4Cˏ1j$3\2%Cskk?I TvULZ0xN8v]Uk'`V^;ySJA.!XfxV 1peԞuU!nht+c:H?f fAS{G*nxĩ:a#;۳W+׳W\Gw~w"Pԣ," _}_wRe@$}ChP>WlCme{y.'ZJm{bc3P4@FHI$I$2t$I$$I$I)I$t$d$I)I$IIJN:I$%)$I$IJI$$I)tI2I$I$I$$I$I)I$I$JRI$tRI$I$I$I%)2t$I)I$I$JRI$y6x Ife8 GI I.I$I$$I)%))I$t̳YH٭o*JߤT )ۢI * <%JdJ)JE<FJ@B*cHJhJBc @O%1 !)6#BJdSnL]&"xR-!D@oiӺpva)(zH[ m*Phn- ;TSRRKu)Ĕ ~JdIkRfLJb x#0%2 oiTd#Ɖ26TZ$"Od llrpT;BuM #HF@:7/}踤J 4?</t\LkG]x%_-)èmN>G/8Kк۶W\ukGtBJ%za ʀ#h5kSo`iS MfF%$@P$DZq_Q06>hN2[TqE./\uuĝ|ԘcSC`^afT=56[D5 i$>\% _ N/Y4L4'gA+:o%6Ȧ8zf_ނLO}|9*))~ 598 MxN<c) c%,)$IŒM!Qo*mN$NT\`*GO3;4N !i>~i-Q>~);|Q:AQ8'j_!AIȍKC&/(%+Ȥ?wc'^B__! " QԏEHd}oQݷtúN IJM<Cw&~oՊ%I Hx$ɑOp$> 9~`!Ƽ#9S`v)<()fAwH>Ϗ45Laij(4OT7N.u:y|C$?b(v|y"Ӻ} uʺ\#D_C̤xw{ lqa1iYPu(l?$7{y|J.uh<F8A'<4x喈QWmD QnیMb`ocoim;}$vnO {(ޠqP A qK@`拻A>gI_VIhJ6FkuUiuh:Mvʳ &?E7UPGI6 t %plG)Xn oLa  U溠A;lnpoV3Y&G>;|=M@PE쨚sKwK +RO%I{ H5](4I*!v})&Q[W}~?A>eA- n$@4οETXl:M n8$h; ,kOfߝW^=RJ6R’-aKd :~(Ad~jH Oҏwd Qs7ƢiM24?=E{%<]IZJTHsp~iG2D?M ģX*3< ?b 7 I#(X?"'w~'['Y8g(UN!<5?AzHIpu)>:!]\;vf;vTID04=ڠc>ہ ji| wN}nbݧNT`#C}Ds2'A9=@[ٵ%6t?$7ih'XDR۠{dH$>9OL. YJ @I'JŴ nh%sdh֢Qc`x8I5ȁHN3Y%5hai<(8nptQ+øoj0<8I'ܒ-Q̡bm;e@.?5Oii ~c 鈒dn#-+-uNistlڴW{v'M'J*`(5KÏ#OT}vX訇ua;R|uTVIO\O Gjb6 vJ)4@ΥޫchMИӎg< [Ϫ6#qO:u@HԨxRUެ̱ø!DrP1w>ul&5'Yv[^}kǕ[Sh:j 1>Q]2(R4){q_[anU}SŎf3QSڑ{ilU$t1EK8V+xmoCkkx{~Iq6fO2FO5vʞCyc4K"N Ph款2kk^'Ncƍq/E~[JNx.*`VOЇ \"NAE,h <*"Dj%j4pvjy[MG |;zgYIF*4C@hp.qj:#_^s nvvbIs|5&c^փErmے[B[<`v5'gbN$:=I%f: ̩^@9𕳔hw6K76iY@!M4eI;D)Xk@BĢtw믺4+uP>_VtND=Z5)PQK> -+׍xm@$6fX]0[ 9eX e$D:k wC18[~gĠQ9Ã5Ch"bA"$+kNĭ< γ )vt\*Dɞ|uNƲ^(YSCN#oh&U>GӣvgeWi᫈ >[tstx?~e sܘI!NBT1ChH{(]62>);l}] Go1632LSn5@ Bvk?# w*iM|—@l& қ-%Cdr gwBn5t8~iR̦E\9w#,R#}unޒ^p;{:Ifߗ7?Jej?_~f7'nn}_s?~ʴ|OK?RLz_ 忟>eE_aW&O)М J"uIK$%0RQ#IVS8ʫ٫x{FrXW ΣqI^ՀB-O .MhF{Mn,p!ÐyAtX$Ut+G[ͷ5{} r,LRȫpUp$FT5KhnTqu rg5rJB HWB.[鯠-qI#Rt+ Nq<_gA?ڪ49nH- \9TDc8IaGqc\CRw8Xts*@%i 9mMtNwrqQq ]?*@M> Z|7Ʌb&uܩ^D;Hl %Ju 8ۉA/O c'U34A`><`ݬ&:{uEH5Q, *?͎V\hAuV.x"5Th}_aƸx"4MWX>R9:$T'S\(;tF7۵ ~iXcDwOPKj!"\rksw7YEkF; LΥDyXZ[/yxQC@#I'^1md粃BV;` =%[QZW: LQk=)T.-#Rn|.u]^;V Mo`Y 7Gܯ,XGWvnt Z n/;{"L@z:Hޙ)U^KH% 'ݾӬ&۴OTL;gܒI&_=) #h(EADJI(Z{wj`ﮩWx%I$AiqJ4)v)ꤡ$0, >\GOUHm$=hJZ\=\{*I$cARFY:I'o*NBjƩI$%9t 3PTI'yF4SĤ$I94$5)%I$t5E;)$Rʘn>ij>RNM)&\QK%)4*)CcEM(I^5H8'{)1#@ Rb!K!\W Z*6q|RSS;R)7IGr-zX*T8g^,kZLHTGdE ՛%ItG-\_;u?Y~vdƦ#am?z8s@3DI3XͿqD Nٟm??ڣ[65q^ͬFnc~7ht?;3}K6C呺ۙr\CwGz `DA5Q4;hB ɷ9Ɗŭ2KNNjۜ{ 'kz??PlѴ^NDzߟM62 >ݮw]gzUְ1oLNU=:lqp5Mv~@>tB?H=gO4Hi3dZ\@lGGҳo_%쬛ٸm T(Y[79-7Lo:?e+32eߦ2mΩ QC{[= ͔:KG'{Պ,-ͰziKce7vdKֳik? j1بhcXp mz*/}vahTGqdgy3UD \;u%qkH~t}4{eWƆ|~  {?H~g7@λ-i"9+b`m`v I{ϧ?v1\@=n;";-{K['U][8Ƴ:~k=G%fs 3 q-!浡I.t~ĭ}l7:D^xmk3>}_A,<ɭVl;?&STXbI?FFe5SEnYii(wӳ&sv5I$"Ws(O14Y61!^T] |+cpK75S Y?Ur;1#[ϳOw~9/s[ GѲk^X?O?H/X6Caw[jqʥXhog }lܿz?[/ǭs^ƹr5gҡ[ϴv Yk[{?}lQ̦3yGr=E+sُ.^ZY`k X -T^UuV\ f QѤ)5QoP&{X_4Ѧ9eU$uf1=Qv]N; VFN^Sk9.k\Me?lǬrl #GT՘ۣ[?jm7!}oC s=˝/M<~6fXO!'ǫ2zM^E>Bv7WЭ =6[iMۿEVO%бg~OTTʧk\H9Jي@Hk[INEʤV֏ɱTedoľlG6AQu?YUnǽ˻Z|GSZ_e,cIz{.FYkﭿgİ%>=o̭QOI5a1&G[l(Z^ k4'u- nΚOܫ +K >Z@ڜ>|kasØc9qo#/ku,,y6Xz_` p:yw9'hoW5cYWIie9]K)hh??\V}5s[zUcF4`wokC} t}rIxiQ=r>Q~?jm acZQ2X} [?K/Ϭ\^u}~<׋ӚX?I$ˉ/cr+bXbx_bNa}>HN`XKݶD'QuTk5mM#1D}t0o"ḏ?uzJT#W,s^R׍e SStn[6ԧ*%@N>IkC%rjiGUM/{bұzkK" ynOW"Y3n>8i*Z1[%=$?59Lci5Oyhvp,:6-\ٝk0tyصzȿubכ=ڈk3vWe׊&Q2]] dI#e4$}>I!q?HC̷_;\mi>r.VVvG {Dz>64}n#EB;Meuh At=u(68ِ?8{\b$r|BX‰}I"Biu'Q}4Cey?,~^Vt=C~[o}'WSjsCH0N?=YEtE${v*L\:⽎h*q|M<7Η@)BC*l2Fl ?50a?K( 1OX : Kba=(6sF]⤗R6t[i9Y@>*ʢ}q\WX5>PqwEnBc΀h-LDVZ#* a0 hV5- s>Fb0 QԾV֘{or>jS]x2Ѡ*46 v>\Uޭ[~izFM7 D;;hI$I$I%)$I$&I$I$I$铤&N$$'L$I%)$I2t)I'I$IJI$$I)I$dI%.I&I$RI$I$I$I%)$I$IJI$N%)$NI$$I$I)II$I$I$RI$ ]h*٬%d(jl+>!%'QMC4I$ I$$&Nt83PG$lշ;~PN)tLTI$I)I$~JI"L8I2I)td&I%*铤$I$$NI"QNI)I'L ILN$™M0SnHXC~"TG)L'%-V‹B=:<OIMJL'C2LJ@X*ןrk?̛2>J'3⫏>UQW:;f|?o~jπ[Ӗog|w\v[B "ғڻɪVU'*kbf澶]uw$I:.+}-YyT<<}Dk&k+mv[ qdj'0kow J4P4Qt:Jl$!OFo#IrɓDDd~%GPS“O(uSDď T(<LxU3KqAę $GAQLBE!T?#yILJ hy'GA @>C0xPn)?$So?rp?5DrYQT))b`(> $Ф;0bp (!by|u~wfҔBx$-˷1:!T`k ǒJQvkQwm!;:LuNФjPR'p3 <(d׺p9RN-Jԧi?2$:ptnq:κ)2#|A{(='~L OKte|F6kVIdO :ݿzfI@R!2u>hTEVv0iFI?j@Ev}7[֝4)ٌK@ VٓDpFpַyL_OFXv{Xw -:srk3xWX6'4U]u*.;GpϵO@{Fց8n ΟQ-6ˉV2c'q㱰9}1d2)n<uT"F"]YЁ렶c [HMf\dNTZCÄ'}|6C뱻ߡơvS)f82ZoTy'Rn3Gs3YqQX\~Z4Mf[ `i(v x"+i^2 Hʺ]]lѶ@?b!Hb]h8hpIDGKnȘAwvI'n`C[ :_ *qJT $ƿmj&'0DƤ:tHxb ;'IiI*p;)pdǰARk˵e:];M6VS@`jc@#_us[:ci#M4L*DߺmH L!WtRk1x+6@l7G-Ć8H$޴FJ͚SRs=ڸH'aEۤO(_Y= U\Ӵi'; Oi(-Ȕ=tp>xs1KU9lDZށe{H ?B˄kݓ$d?( #S.A̗Ѵ[y" w*o%j gߘ'F<] oQq!o?y~rp;@k^@Bݸr%8p2CcXg{$[gP'_Miᣇq_%Q'p$/V\7d9ϒ<֎SmG#v!Jʁc>5tdY >Z )?ٴ.{ k'"qK$42I"ٚᴉq ʙC~ATlƚ i.{fw h`YcC*HsL9$ GCgx pEp1BxUo[A8[ ͂4Vok3&sF|5;*hd?J8npo(F&}pP"t uDeV{ynL ڢCo꠫1|nk|T]]nj!ḦN~A" tiCVЈbc}q$]O jJc8V}Eoy_䰸5Hz-7`9iGӸv_!rP <4!+5no* FƻcM fyW*v>N?Wr ;#BK|Qu?ݣy&> ˠh@z~>NJC*Ba:{sZ0O+f+;!η:ya84Xwh;?h5 eYg,T'vPvqqN3s}!5m &>7"{$fN7g~PXy~H L6?s]&F*L@V{ v vLrfNͭߏ#a3UdֳhtV+ k5b'=yUICPS G f ,.O#g= sh1[M>~jX KX>{Q7W2'_o`zU3z/0J:WGɣ̿GNf;- yo]~YHD~ʴ|OK??RDO-OX?/ + i)mcc찱ngt}4 m|I %lXi׎K2^$Vc=2ǃܮt> @MtfbՇ5~# K^Z50TT@vݖqy;||څi!ti;:\Mouu! XQ[?[Z);To.a %'8?+hz4۸PPtG0>"5 "Y~yS<~D,|v7q' T3*uVKDsKIîa.f{ps1 L-¾wrp-vdv m\E%"ZguzGBdJ`L׶LϊCGr1꘴7DŽ LRԩ$RfRqQ%RJI$SvNЂI%*Lˆe= I0:hh( {HRI$Ọ>~EJI$N^uѓ񄒤$%l5QsIIL}E$A(JT0MBRz GJĦ:TE5:å ֆ6Ԥd)LJkŎma a<>eеeA(he-kH7+c Dc{f9ۡ C@''W7? + 3 }?ɱlx]S=2l29&semk$4}EVFx.#;59:yRikF?~+Z;PΝ?d`QKSl αalﰐɉ p0ASasaKlw庖lg&p6jUVC<4%I.H$="{ ?_O4ܠ=dcM[lo4[e>D{ug؅GO4KK TߗC8yRn<=]ajd$k,s5Ma۱:3Ш]p2?3?Km#ѱS긿k,ɶkkk<~?5үBDaƆD幣Fju16 1~baT64 4kWAu`l@5m§Wm_ki{}"N=KeSmd;o?6s*˿qgngZȯ+KKe̱$%Ӳ .s>'X_clvK5}\FokA8}5P $ >^h54\G7gsu.{N3u'*]kƭnkƍ$7e6ۋg7> 7tγ9~L hQIo kwϴ}-}bՠ[oE|ځEy4k3ic\nwoy6Yu.XkGG&Ps^2ۿI{b_;ftm?ۊ2=Dr D/z65U\Z8s$Jq[GE9 o?+y  pGk ECfd]`uBSUlyKv1:h}ƀ[zն^6C= i a6N{}ճ7ps?7JVXחpcRtq=ӦIݷ_6ڼq(eXl>XX\_v}'+UK7[łkd7'bi uY>SޥK鰟kf\LFvk: w+kAmm2Ѥ6=Yǹ}'H'Gb^j>(:Ukj͠3m  jln&5ylʹZ{_$Z)4ِ2litQK[?BθbcLSՇM\YC* xbE~h2D߸vM p@n.W4G}ܐfn^H cTOn?wzKe5ָGIY=7[VzQ{Q?ҭ+u쫦9ҫ]oEZm=,:˨2X$o1\c$>@ 2{ix-MJsYsk*k4^}?]Vm[Z!kXteуY\ sn%_Nf^SQ+"${ﮏS߳-H9൚'=4ʜ}C龶|&2m{$Gq*.N7y#l"m殺>xʼ%'lLoUl :3}GWe4sZ=*nk=M 59gٓxu85?C*g"˘잠,Fmlk7?ߵͳhXa<(e4W4{=oj>~}Cќ6DG7ȁZu=w |b3YmZi+fejMc]{ݑdz׸' lWU#=8453$ !?1!^Kt^M neϤ 0MOUn{Kz076vKҭ  P]oT2f}AH2A;l#e?dU Hkuڧ˭sϵ+o;&m;@cZ շ1FrJhM{ZlfIU-^\n]d<6ncQiK?.W(ձ s?ٲeb` o2I)bP9`YU_V<e{~?}X؍&gNA#XuSlk{lI'3ڪ\nq?g+}0Qd#auMEu,Gz75e sdF374Z4<~rmFhcgnO$!K'f[ZGpO*Dξz6UY}.{Pz&c1shxoWs?vF:@<SqUbƌRɁEN=.?qXɸZ{N9P&I'vlU=Eq%5s:isK@42U9+l&VF 2=XM c067cX{=gεUpczYƊ6ZoX/.v1wX/A%li=Ǘ19Í`Px'}K )zUkƲ۶}ދ?g|f2;r~}XeɟW1۱vX*h]*2@<3ޚbbZf} ݽڃ3 }UxشWy8j k–Mސjyrl59H1X>'_4J+-Ⱦ`k}n[[t1¢ i1w5Usn^6[hN[}w;K;ok]?[jt ג{׹ϼdV+!5v׊ͻӔe깖fT hU}UQ۹lio̶kpwsT@懖{=Px~S\{_'ER{!6uޝ@:DM^f W}5>IKicfݔRzn+Kklg[W0Y{wkC37fNS29%=#FjdSŕY]rA_G'F8 _(14lvȗdǮG;CowJ\w8X8K~P||h:8ZփF~'klwQkO1w$%˟$5hmGm 1ֻ8FQ.ՏX wu,;sq/Mc`R汭s/p~L?CNOdPݩHiHM^`vt75RH_5ŵւCX_bfY9?gEcFS-:A?%Og1eSvNQvR$ u5%`(4NѴ@AH`4WVLŎn<EuB< eof5?CFYVXX5vΤ4;A69L>cjZˮ:h:+6TKZ1e>!ڳ">q0HSm/y|^:[EE?I%]rnRI$$JRI$I$I$$R$I$JRI$I$INJRt&I:dI:I)I'LI$$II$I2I$I$$2JRI$I$I$I$$I$I)I$I$JRI$$IJI$I$RI$I$TI$I$I$d8W_YY;RG tDSYAh5MvҬWh" ]2tʺH~ ZH=R&Ne/QIJI$E~ /d}#P*v}#PI:d)dI"P$2DI(R$)'LJQLI'L%.$ɒO R&:I$ !DJI\I)E$$((+bT" +n4A T.]۞I!9&29E-꓄ GP Ä5&TEe0 aToQH<ɏ&O > W*z(Gl;F~ UBZr羶lgntk\H!P9?HıU?+.>Y0Xn{<}f4^vZ !T%j9W*+hcx\OԼQvK#?zY#?}PoUaIt@ >z"A$) x&@DhA+S =Ԣt:H )'i|tQHBS~_ 8Rvd&ox !Lxw:k0)FT0F):b9P'M?;xcT۪Ymd '$O|RL?BDOLQ2#|u_iԛN)c ??c_p<4RS5ILKRd(}KLHqFۨ4B{#ޑt$qwԶ߸5@1sĈ>8Ɠlw!D{Qϊ^~ cp$8jkj1hqV5(w}#J\$~oW)|r_YwݕvS"S .r$gM`yV@0R-#(c JuO2औHNW8C^e'S$5k%HMIJHV r9HJIy!832)FĎ?;/PHMTvD( ӏ@:;Ǻk=GӠ^H!ѫ3I,BKpQI`[@GEBvIg^~ c~Fj6)HYi&t6icnn 5V7xSfA'$Y|0H6[pd& U0hw8cC`^*a h;J$^LNIĸiIՃPkp tF[[c#?Pc,q{#_ZӑL|=8BysH:y0Z%3l_ˣ(gb9II:}@r, SY>!?IV0<rJ{ T ?͟DvKphL;4[~r)2ƥIGGC͌L,K01#PquluJuX%-Vm2cò{ޞ[M{A% @F)qqyyFT}rmq?͵;FuӺ̃QVZB 1OEW3-j}Nx$TRΈ6Z}Vr~}66DDҠh5;?GufmY>?+sd);qkHh2t>og7ks$_j#H 55(A1! #;ܼ697^'Hw" 7L$kNAX G.1㲁skwLl-y<8AEDeF״4`0#CQ5-<;HRHSZ c$r{') iqy~>=^6J[?s]K1,p|3-pouM (c&+L&eIXɏH){?*TA@ /$h5SLnd4ՠT\L*O-:Bcϻ$5KW:yH7ڌHkC~`lTJ|Q. H#w KHm4+>h>W4w#zaK$}QN̒oHb1οsF4@{)yO)CD4V)3F"}ovHeEp`G줭ZQ+qA f?費{DA=W/8 vdHV=_Yu1JqV^';!J!tu]zN'jӽp>(Oit0DgD` $IGzFO'2D:"Tؗ~TGpGJ^\ ?+R+ @-?z_y{#$XvG=~D˩}-L5޴~{2naJS'{Ƣ~:_c;H< KHʥA2rTCdG+,,Jä>ds?Ak輖<pݵ[NeV:o"69#3F+uf$vnDB/!U xa?YZc=;r̭~nԕ@-{D8%Y"\džOe<59Q\lQ9V5pj``Lςg<t 嬻v0WE÷l >Kp]gnxAWaz|T4KH<Qe-{Z{(u NS5'U>烴4 jݒ;|GIbP7pt☆ĝ<6#U d1Tߖ\`8Dz5iVPLt{5Fm3q'#beC@72@oΗT2A0ú7H擏`$ܦC\nY316x[35T>9lԯwZ-:MVW?Nej?"D @{-uJR}~ʴ|OK??R98O-OX?/®sK bY o?԰C̈́c?צa܃x:* BfF'ZLk∢QRTI0;K_t͑"ACw-C0,P]EK JI% O%)$7es䘤ӄ8L;) JIfuL&1%5,-ߍ`I?rA.NTg[E@fGW<j&S԰'I%8|Qk9$R&s @*!)4iPYEJKͭ;)ܕaao+o([|g.uĻ 9+NR˪z8 wf*i# Z4Tl`oʅCK;)Cx&C|5E=P5'pIgiqc]V4=k:4Ska-ПʦZ4*svx$·4ٓ[`XQxv9!1OSeG?6 =P\ &}JZõیmVH5 2IZ7PýGow6Tu)dKsLЎ%Mx9'X^ǂvdy(XFZ{kPQ{ ÒU`Gt7RJXvή*MxƂ]òxUҋ&4=+<?M U\uQbԺx L 舌|jpl$4$Fi%e{u nVgah$GS晧ԟcJ~I$M;\ !pd3!Rܧ%opQx)eW'-8+e$';RAISm{NURRh>&hTg0U)pdIDNa۵ٚRt*gS q*F]$L$tKJRI$Ro$RI% "Q ԒI)m:$Iܠ$Jl 2A*RI$S%L;A~Q<]2tClxu ӒC=)R<@QAܫkL5K]‹pRo*Oq=T3Dhܫv#BE`5j 1 yTSwDoiT .eM <OlX_A=;j*'ֿc }?; yq?K IB8Ӧ_XIJK"{Ie-;ojͽ5pvcL6Ga q😡EfhA'k?Slo9B&#L;kG>hO>B֔ QdLk }~;w`[S {>:4f3q|FML;q$͟{(dX qw+u&Zu%ѾM{G~šu͇2L5t=W/zIvk~1v3'eWC^e~{Q@i3x%pkd#$)H?Mh^Lr(%{6lk?kv{7c#ݑ`kCϹE/UV;5?a/ŝmŮ =?37Xq#K6!p&2lx?"O\-Ix#.}027-X~WIe1 ouK0USKoj,~CH8NI[,U6ɪI̯߰w3eՖD ㏥AEksG=cZtuP/GܖYS\Kٝ >wv6+=+.;:X?ퟟ԰p}kxkk kcIe'?~8acx}*?e{#w/h>:$?۝ ^mL?f| Sma&KdِYS'kl^z_a6X\㫀y~nج^_W@#g47V[Yۨ#hjgڜ9s=ZCLD~kXۭeGr^kKC_]_g?+M.S_u?}g<ǵ ۤmG+^p+C&gR?]kFiZkl{)pqo}; 4}[j6HC9hcU$8O/_5{ޗ4mn`yRͭ{=?d;cͯ#f׃֪FU䷪OI6=nLm.ZLn$ p##O=1Zh*xaToH/$O~rU^feq8a]mzu/MpX[\AѰ7nkoXbdƷ5;Rd~MH:۬fֽ6c:os|jZ^`F/SEY 'kZqۡ?Dgmωκ0 k] mGv}_:c9\ḏhNuetk]Y5G7oO+E7Չp1[{4 [ONkC{wU+>?UV]H hW⹌ʑc,2At"X8|?_g_0woy3cI']V1}ѰLlO[i`s4{͊?OwPv:㪭抚ݴ5 f7D`bd5b׵dkvme[kUuo6 qݱճgwWNg=0r􋶟O9oZ#̛vKC?1O<7 n_q"~g?ѫ}T `_ӫ_1vw =ޗO; Vea2l24;[VMvs{!1 }_?vfd6=2[+~g+ޣzKa@hН7l=^N]h#$^hqܯ癐@3GEwf22TֽΰV֟InswlO_} qc&}ٻ^jd7sX{*GQY0g{_TnMx?.6'sGQ* iH5U19UO;o[(w:K^-Lxjma;}*XB}5~g p.2L CY萺׭3@u;xnSE-ftJeDZcO:8ִ!Yk ?_Zs~}XV {cիV,@;Fݡ)/m4vGM[u=I_v'QӰ2no9? '=}7w7X#a鱲&Dʜ_ֺ(o~7WRecDlq&kg@^ ;w8IXL76k{\}'e_. ~s-4i)^%xj{ } IIȸ wYf4y049K&(ffߢNŠt}}QWyNˌHXob|1]nc?4ډu"DTnGoahwMK%P;v{/u?pi ߫_`?#ջۏV ^ mY6_} ͟StY{rkyi.:.S=yUÓ{q>ցt)f0-tnO$e-$]ho{VoJVrwR-o{?F*c.۴.\v?mnL CB h;ַEZh@WWV]WXV?b>*ɠո$meL-}4Ԡ[v0CB~>ۡj$˷}~kT3r+`TAV{.97QvXǰ%wrr>Kg(v/s@O $zWK9[hH~M,gQ{+w/pcqG\sӪۚG=?EG."Kw=SS8_;]'OڛE{kԎ JX/?Q*.,s(S݃e{ްr@O!?;Բ^ָߤ4Tic# K*epZArġ 胪-yU;qni?G~UIJzY:ҨNMC_[ ~zY6>@/qk?46kIݣI+!vl'hpݧfV: mDl˥[Umc."Z>^uzU;fog_h k>tQFV`!'0 tc43⡊@s @)On+/GݽK/dAaWæ5s4~Wc40܂Z4nwȢd?TMP8h(_tb^ڭoq 8X'Fʆ>5nhs5{8p.yO5* P"b D7P4p):GZIifEU-KG~ Cl-6$ǟMOxg R缈($ʓ-2vN@vQ6⾶Rugz8'Ӥ.2y`c{`k44۷FS2a>`*sM.mRFv[T > F6uHQ8{aIΥ 5S)U"P_Gp>S: k|;!XZ#C\ƾS}DwxEM3du|ӡ@?Ul_Eh6l O5SvM!I?ef= =,B͹̆/3'(E3pG~5& I$TI:I$I$2I)I$tI%,I$I$$I$I)INI$$I&N%.I$IRNI$I&I9LI&I$RN$RI$I$I$I%)$I$IJI$NI)I$I$JRI$I$I$I$I$I$RI%+Ueɥ E!"Jv".I#ȧmUOP-RT8UX V7㔒-7+rZ}"QnqUeO I3QLR- KĦ2 PR" )xIJ $'KR4Rj'T<$B*]$0)mJ'$IOM;yKSj@)@DŒaFT)TD( ['0:A Gts!E@<$TIH4 H(qʘ!Mԓ$s:B|%ThxaT:ú*ZF#"4W[~ |7hIo-p"W²Zw鹃.nOtZ9Mo{9(#^Z_p{'@ 1xV΍wU\"%s-e@r`8%f7\6Ĭuj?&@ˊD(t{ k}S1 hFkx_qBpߒȢ1ShϏq'ftD(FSrxRf92:G AƜ!'RoRL؟yIKhLOnTET3ā:dꧯ#U;c&q♣aHp-pI4P:h C];&)wA:('y9t|?R%<$ qZv6#wy_]uD#+PRÎji=l]<Uyb$mS E8H HՉ<@sߣ'r>V:vx7<{IϗyleWjdH)U) s8Dsn\+tH_j#q"~jO?uy3mfz:N \n'3=Xcl#kkfc#~+}7Ype .o mxB&U5f`JM URE/&M#Cǚv0{ eM9bQ륭o8dWoDTԑC=TkaAAqKg%LpFF4=O$苏sfӟ4oٝ[8, ;u@~#Q-y*V$˩{ORW{3Ҡl$ZOvCsH $V3akgY` q@Òf?y#mn$!ڄ[Zww<:"+= _;ܭQcC{I窶4#Dv׼65jKJR'D+mNO۸E $pD&g+7 ?-t:t9тN砂u_t68m߼$kYd5:2?ЁG3 MqVC|ɃEv=򦲡`qt'I<# yk[:GPn ˎ{kvVNw k@Ӷjl5^\lAi5I z:f?wެ<=]Pʍ:7s ܢ\ yyPCM;KӶtUcCgLG?E&+.'d_ &8t1?fL3H%KDECn4~'Du4k}4mѩ0.' {wVtQIVȬ~pJv6?[{ ~5$lP]?Z-6*DU/F˵:L+Π4g*ZsLj?(x< xA;SZ@aeHG$?ϙ#Txl`'(5r-{INhF ǂa]Kʕ7s\И4#`afLbqyp&tGI:|L1h0I@ ߐjA ow'!t;r+;̔ihg*]eu.&fGP;Xw*u.ls=5f)JmeU\~}+v?A#Ejsɏ]j+ $z ێhmpk?*SƂGo}w|uTn: oܫ;l|M IzB=3sL>|5OWT\hbO'ew9A:\I@uA?HD*# kSlno~mlf+SjN!|K!{a=mq9LATJ$@Bmfkc@tT~NהOu*6&|ƈnZ&[5<8x{-V;v*>3XC+Oc*UL ?k1$+ {Gt[4JԪ[4MM!LGP]0#醺gHVu]*.fKM]e>)KnI&tGvU\b=rEW5jL~rCZy vH*s%܁#y TN$HcA}p, k1evF Ol[Y-3_ycB"er >I_#9x'NvcjhcA11S{*As?b.KX$#Ad+:ádT;u Oɩ+$7K.?!sKy]>4oѾ^֟pGdXٹK:l6Wv6Εi`W҇ڏ!vEmg[\,;$~ʴ|OK*?/[?/e2*7:Gu U q0ߊ笵sq)uldZ)8Ӕ7F{[>yNv*3 Or 5<Ӥ[qㅕEc*cE)FS+1۶ǻ[82GAXms\ĆJ\ p5Пj M5N%Y {ӻBS%NN &$x3~;2A2y)pAK^Hc(y#NuYw8g?T%/%@StD)9ਔj6cRbt)SsKVs2xmTڛyt*lY8qB_0\ ,RI("d82[kG?#Si)>IV,ecR%kg*쬴dϒ% )LOٰ4E~껛Yy#N<}!ʕrѴS&Dp$8K%"$Dq9 tA~3c{ vQu'8Dho']-ȾFy$mm`rO2QwAxo'+;EJllᩘDFY-4IKcVX8F$ոTvGy-:\: "YkZ ,Ouv$ mui3&4D{! Bč@GӼD*x <I :Piaׂ;TK_4GdO*$; 5N${5N& ܧFLOY+ `ݪ4m;A;)2tt羁5o,~ xN)."I;R[07/tr?N~_4b/EA׊l<4೺C\> ?/+B =|U6tҫ0*9E'%X I#*]IџffC1}ޛ;: i^U>^=a0Vvç3˛^:87Dl%#$ ]'ue\F$Gmu`"$7OOߠC2Ͳ65.d"p?; `94AP 4Yj|8{E6;֪IϷ7?,۪7;]?v\cll90].w$۽%Iֹ $MȆwItI'GJ9 .;Z1E6eXo/nhTa>41/;G߳WS+堀TvmW;v~fKNH@ UXD%JǰebK.'j*n<ck?r;1U12w9G38577SNA.!~d~gS_Kku9w򿖜a#R[5ޣF=Ur'^ W:Ͳ&,~^Ae~}GQc|[-7YOߧ5VַkKi.ZWdOV!ea߷ƠM1/j}6¿VX.y41ju@9~t{!S{>Y]~jv׭ME4٧O8~OwP3̢v[qkӷ~ȫ|V2_glPé^ Ok^paqwͮ!E m_:]43yt6*]`x.kZ$kc1έ :ѡw1/Tz}+G6l~M{_GfOsM\'vHv9}h k~J{:[ՍSqAyakZ`oOMc$LsC,n]U\ K?5l~RQs!m~}g;kw?lVFC:nKY8{fWG*2?(r)k\w3}~"m ' VpO.IA-գKW%đJ>U鲦:tGWT๥xMlk;# Ot dv7:.NNc+͎k`2 ~Zѵ168Ho ~zqkx|ph^ksgI ԼRluzKWC\ژw=gq{@Yk}}{v~W k71-ɮеti/I\ ܖDIG$UTDq$,u @&;~`wȵR+q n:ˊ[ﲎXȷ.8E=+[ԯPrFWTN!qYjwڛO[9DwOkn2ڥ[nցo۳?Ursr6J yth{X~Uָ>= ;* ^[KqGk:ϴjxH$_u׶goe8X6==olu,sNKfns}|9hfL>炙,%ǵWcn;+fsi?1ZŎэ:{_]0d{_n{A- oOm]i}6yxZ_g,U1=:=mPX,.蟇nq꘍|{C`"՟k-c{s\Si^ s:Xv[X>C@ s,giu,'M6oř1m9}}{?ICq)s]fʫ,ۿ"?}hYux.hd4-V{ Zwvg蘘]N[&u&Qy\LKkƬRjݍ]#[ (s: ާ?OmaeXK\6}=kg_c@c{DZֹC"43aJdyAk'ɰKy?4C)(pyv!γw7~~Fc4HOgGĭ>{N[ޣҰvs,+}uIVI[+hy'䥋v繌q( 'fXn9Yf*n}~_fYU@j憴m[?5+~lxccA?"WMy83_V9wfVV[@dE:x[ol^-hu-pm0=K!zN.[a;>5 +(2JƴpƝV{l_҈HGsXHxk+:u]3&!釃 /EnE4ZC}+>ݽ=}&. u߽=/XdmhZGnOOw$$l׊R=ogGQss5a7"wmxc556\{-'G ۭ;79%'H;ia'C <݂CysLHc?=\†c$}{>0m-sE${>ڕok?< T}*McC䠶z5>DnT]:wKjyT<粪ĐD=슺Roa }?zwN4]t1q֧K5AuY"\Z}g/4imkl?𿾯MN~/w{??*}[(UQ{cvA#*m{F[KW(x\E>bgqF{\憏LOѧSz. t&c3Z=KN[Gkuk*ֿ8켏g 8 ݬz|;0\i#P/ ӗx$uu]c KA׿_yx`=>*VP+dQ;kI%6Sk7F$S[2c_> Tn)evIZ1ìdXCq!#~׊6V 0#,g?*ãk;[S|'3Gs睊dd1[2~ZukT@ { SdCL{e=@éE̷P#o7R:{1K@2@=`-:*-gs#k#oR4nw'M=Ӵ(ǐS䍍8u㺶B{UCt.ek骽`3j3u-ghAԆn2hY 5a]1%2cw9'jӠ\u/H[@qN~AHu13z]ieX8F eYKҭZm'we7uH7TwtƄLb/sCYHeFڎSQe!#Y1rO唾ԍEZwU-j%}MN:kG _S}!I~%!D*ʇU0?4HI$h!I=t) 'DRLGTh5N Ĭ~gq47S~(e҂ʇ:z۸EBP@VQ S] {Ou*m|p ~*\ȁ1\bP=̗[%*%s~YrtJ@ןj谛>hĹ3tjg5Ԋgy-Zg.qP k\,~+A/x.K~5h{+u5w^jWveU&NI"gO5&%#] Mǒr ZeD:)3|~=xN A O:"|S"8N8Z@'T @i)cBd ɉQNw~?9Hs)p$v1'I&<Ǖ04RA14$0%" v4P0t'xNdyAKE߉8;O4Ii):_$1qč7zGkM=:HOIؙ;Dp@GkQ{?NAQy u6 A,wvNk?ΑϏu53?~[&DgeKDp? ΑOJeg__M@˹1H?$6tD`R;I 'O`$~ :g%L|tRx?m*;o<A8 IL~O21jLwJ)q N?HBߠӧc` d"PNs2ln,'!)'TK%c_I?>Ϩĝ~1[' -"|S#fN_櫚˵)G e ^?"9'q1?$p6?b#IZe"$h\f}; jF ljO&&5d0z׍_ Fg}'=ĐNHRHyhN/{LOp1A~uMVDmüO*.݀R@dz~­` uԬ4:ʰW857 ~5&oQ@ !@7)k3* 2I)V"xywNvY~sR*$Jd!z/qM 7ٟU.;k}p <JL\02".lB}ГDm_mxR)donh] Z,&HKkR.P&2j@!&LL')d6{I6Z%%0uM358Laz3!(&?"7cy;LZI5xH.w&} t~qF:qʶr2ZOU{2~;v IT@p#|ѤI2X#hct'" 2I'nzhlky-xiqg\wZ#F$?_rE%qiwD>jDi}-/4*_릿/N@HJuTݕà 3= pM $pAvϟs.|+facCOj -<cOSkkxWeHLB$s P\ISInun"ZHl@ ^wl=]Ǔ&}Ht|II6|P\sI"-@Db7 4wJ'HNCt;c-L6,k`TKO<i@o<MxuN?$pՎf{Q LV}Z2թ[XKc3-@t=U`渻iI!"CFiP1٥ύI+\"F,r=% ?QˬRѴ; :7A:YINGd7l{K0(HV.?hx}$AԞi`1PC|gDk)-;3Kvlj?j v2%`ˌɑ0}ol{ˣ!݄Ug 8lH״$xj.irw~rO J[?XNؐ +;Ca׍xU."8CwUw.a=A$bzn:40!;qtgh \<@8ȟo;cDdi)0&dc~. &X HJ0<<ٞO(ي=;4D?ha{W CI;Kf>h6r s [t {. Uw<_Y~r k tUHE.p9Mm;f`MPӐfCt רiw\5?I6=@6Pk(w4NO}Ȥ76!2 Đ?ȥv Q(li=ǞW1hs&eZG%{x-" _o.&}q8#MW>W hm|$9sB65 ⒈;K,w {LDOmcVOjh;L<TZω=+V 3Vv {rkf4g 9#TQs74'^>?A$y9۫#MVG5Zƹ j( hp<W7fA dn cpI :/T@q2.jfTY'C͟>)R.a]XW%?{os+h81nG3je*·TRئ.ehJ ;(]1@PyfeWv kΠ75A>j5۠B]"P.Y^k Qv ;"^{+R]XGQqk:elg^F'2&†W/% @#A>%dEQ; D)uaF.;@PA#2Z2#{ \ֺ KvYRӻOXxNN?H^s 1 Hǂ6ɂ&q$EsMلO tsP!3i.cdm@5*/Ie[΀xe-Qwg~yЮ|f}61"vKvtD+h!=->YeZgw{g%s?[zU?^/m%y^lC_ͣ2ClZ+;6K8ۿ$~ʴ|OKaQh5N?(?|ꪺ:΋^lgjos|wZ|Q+2Ц uI$;2ì9 S9F&saY"LT]U.m sfR|Qʖ'U@68r ]v'73ctD5Js`*n`rCkVq] ? n|'~O(£VYy6* v T)3Pγ Ƙt-sj땍I񀡫Zr:(ƇHZ\$*x^l>nT:TuӤ'K(ƬSLrk#)ܫs];{ @`5/+MֵO1*2l:k:Id{`BBv 5DL)҉SsYSv )35Y~= ۫R4vHT. R~-F6[4gfViD)? @̘j}ZD+Ppf^fcUi%.쳏iVݲ.gxSDǁ%5 _RtX7AV?y*GD7gEem:(c6XYOS`ܕl:yDxR@UrJUoBs\< Ps!NY5~D&ZuQk d͕VIt:vIPpeiQ oF1#Ԟ^ULqgT 粈ZZ5DL (5 CKI$Jǀs'5c -8I( 1;]R*,doc%VdbSHBHДj\$JDJn [-'ՁOWh꒎$R) g[<*S-:ʐlә$-RI$N rRRI$9 0%)$N%HaH=&ϊ+I$w 7 dӨ׺zXZۄБ-iHRH|(VuGi+'LB 8昸(6RD$NI i!q!ۏ xQ"BpK!Nn@ A|L}%].scx)KÒ]> rf9ΰa$VrVؖ?{+Xy9wX1:&jaMZ`r'}'#fZv\"H|6ѻ Kѯ}CAmhLwzl{ݮj34AȎtII1<a;o|:nQƪm ?M}b5Jke%֖8svlhniG&q^뫏Wn~#B8KY}yky7 s#.=?ic@gHneţbR6V y?jV a4Qǣun4:ߛ߾x}$k0='s=!J c.Ůqxgskʫ h^ϡ^E6S2ey6+Yxےꫭe:~9}'e!d5}Gf4;ғݧG;/F?E(6w I'f]?9}Ϭ8LO\7l>EMF@2k{Zeq\\v;Hсϱ6ٜ֊6z%?h,|}§VP&ݵ.3fC@/txEHhŠEpa'}cԝVEec-fβޮͿAKƖ<6^jߡ_'nOmkksoۑFv`o6:ǒ4 D5/Ѭ՟ .hIuBj0GWcP4HSjkw<ƒ=[6/D4s~ml/ڪ ,vZ,kuߥ}+.v#OW[v5gu\:VYk{}D ^>*_{jK;w5fn2Ͼ֫V a AgӳEeea!khwo#1ql4h @_u*3n_C"Q:n%2Gx@5Ku7 yp._f.V]~VXAsoq]}/vci??{~Vq(5hwh'Thdz 4Rk,h)4tH '0ZZg%যQ.qH,ahߵ^Vb+;Kp~oѭVԳg|=SgB8L&572o V3{=`HM6.<3_Xw*ͅ]>>J]bQWSp6d\YNư{k߿Kl6pQrL|渙kAcOk#]~V{7s73FzoC--njNxa (= cEo;CrD!~sGoo1Wga51qkW*ª[CJ3G9g-LB Lu:jUkK+;f~O%*ѠhM>`?νͿmԱ[ 5sYM^;e\6%ړ{6{e{#lOar m3&f$vliOc}#q+cv#5R1s>!/h[`vno?V587xt9 n;w\@ߠ#~$PX$;XnnƊI[OK*mBI~c4N܎!H(Wue]՝yٻ%Rw_; }M[?j] 6̻r0QQqh469yY_=ֺ`Xoѭ_Pګq<{.tD\[%mgI O&oASX JTnL] ,ݶkXo//1ŸᅟCCcߣ^Ϳ?5,hsaǝlӢ5ZoTl9<3sv3[Spe$5b3k55 AD@{;KMR3 1 w}v{ٽu{qoUW&]ZHv;76V8{Mk,}iئǵW&|w![ey66 wme5ƧoF{]nk\ŢvC0ݞo=.OJƻ) %~uU/GŧhnEzh{t0z?5I6Mٽ>h4})ma?LvlNin>0T 3wQ֗8ch'$3Y @;~~j.dfkGͳW> h]}jXI.[\{?s,i,Hh?9C:mm48zK GJMq{> qP-{(5{-9eD:+Ko>c3- jm]K?fV]xle{r{=?_[G=+Tَ3%rwlm;`S 7ʎ2@oGݷ87pgkk emhjmHORi8Z湍6aŻʹ]U%=_?r3 kջ^ݕo>KD}7 Q{xF71EƗH4#:o3ۑ@ͪw]ARK@si}\nU96AձMT6dz!u3w~3w!5.$· ÓʅyN)nA2~ VI_Z:s5O}GT΢!ֶ9?b6GFUٝgy,h ?G_c[Zz~|OjZsGos'kulq$IwElc3 ??jv=4T a;?z]Ƚ^GwSk*aqo6`LƁǚlze#Nf^l%0;e9GOv{Qu~ڟTʩfFvGp.YZ1,aq1 ]1Xv@kek?Mzxvh KWH/c5;C}ە)8ãM7g5.|ŤnH=3 ?>~{hhH\@)sI'ungi]?41n [̗;@Q®\Z<g\:sqmn>~L{O'RTlj47B2.$!*~ix{F$0DOPǜZd g>/W<ștDA$[[ԎC(H@z~Ɯ"e@~A:XwD:]U4IEK@McH K~!U%t_Ѣ6 4qAd9uB%Vշ7wIV~߸=kkSlv}Mw@&g;ABy`nI=Jm{v;;~.xu:`†lw{49HӪg hy2]%uR[X<)MmYHX !qaHJ%*~0*tc"И$!9 p>0_<&R*[<B"yL\{AP +/GѨXOtGil]_>H?@%ұXЧf1!5-a̷6;%U9sJXxY{,bYػ?5<ӑ菣Y,ƉԻUNcuwd}Z?N [ @J0nmQ,S[th|Q^'3Ro>`vArҢJrư<`}Dm3IKzbLM*M;F)0LQ)Qq)qD0gNdO `;4h$z'y#HST pg m8 ER$A)<@NJhNC ?* bLr</>"L$fLݒhRpADiQO_Tnju?#HR ~jCQI NwDGmENp 3*zAK8_P0xR# q &N1;c' )몀/Mٝy!;@ F_z||#֎o" u?ϖ : rcD(7w͎|4El](4OPP!M;Nb }U6a=h; 6?彻$LIt5i,:ISX9С5YUY< [y.kt_[\u|zlֈ3[* sv&@-+~٦\y-&A>4'k,cY>I ac6k*,d'DL[{j0֏.:h = qPmJ 13 05#*sIvf'#s@<ui'Hu?DŽfcհ5"yq%[u%)I yvRpu2L?H  t5CIw3`6{UdD1~ b'טe&c8H:Go=EyLnsMJ+o<&mMh A<^UDS;o?zX=n9?!1:*u&~iDVϩiRjsƬQ6[hӾ '~wE}^cS&<ӡ D%3ɮ6(;_/2H?[;t/;WwqN}Eu$5ۻj[9W7x5/X6ƀ#^CiB cY#>#2K㪮5II i1Oܧu;unOoͪӺKD$Ul4O)t<{\@:$ʧ+/ aLܶ ;?h*,p'?=?Ky2"x$ 6k{k hiЖeU7xH:&05CSNEcǺ/7Q??ܰѵ:=%<ekuq!%Pv$v )$9'edCFAΔ*hv>?ߜloBH3GsʙU~=1׫#^h3A$QkC{|Tۖ*^`L&/f:Oy[g؏hF‹a۫{K~v)*:'iGwpP9pᦪŌC5Gޑʍgt huI](#=vN}!:s'xx&'QCs{Jم7a̦jx!y~j#Ӵ-AM"'8dSj4[ IIӈ2403 Y3[-qi${4H."Ov0mLvSctMAMm%IVôLu ]c 蚜d @hg ^I4Y;H싓OXpF̸9){8 N[ƚ[k0 ]EkgDvd:\U{IBAeۏaS7KgwaS? hzrƟDA*ᤓ?rM%c"OFZAp?c\%÷NOt,|T[SmD2#^$ BZ NƶƖZ\AդZЍGQrȝUUi¸>h=̗q3?V>us=HyTmyqC5Plms`0VdvM2Go h|ULqTz%{@M[\CG`AR5'y&WD |bFg-b8g]a=}Xm!|cXLv*a86 zUdT zj\%VR45सX%k\@$L8jAAʩwcBsEd 2a?jd;۵M[ԩ_[=K)%kK$?s3XİCUP'̷8<)=%ggxh$[;υ1[@ zy讃T dž*ä=[dơV= ,}x w"1SZ5 -F$8Q^*2;&;Pqp lAN-p>su3#0{`NAH<'IS~$xqx߾4 N?Y˳$ wGtu:T1o7*I_^z렎al_p0s/Q0=?Gqs]"8Z+#Y>^宿~ʴ|OKhʴ|OK'z_ 忟>eUYXU/tBw@t<$C&P.A%oo*Q< ze oO" #&mj(OܩU:!$|{3kqM$c̬`G#sѨZ+#Ҵ~r rzdԄ.X7L)HA.QkmdAO jT65\H8ks]o?w+긏A, vjIZPkt|QQ{['rUSbᢵ/HD|PfciҐD$6̡4IV7ma jdL06;U`RrI$ T>-wN"LiL^<8Q-BҺI$tD)1K@`{d ^*dqnXyq?rN0'U r<{ː9p'OL|R$qK0<$:kt|܅֟TmI%$UȠ7P^@i%oo]uݻ)YEcw0sKH;ZyGem5bdABŏԁrLZJlvRR'Dg:a{;FdžR('T-'apI:Y0#6D 7C=–Ii$脔Ph;LSR.jukiSJ5gkpۘKel;{vA \w:k ؙ*uOn$IEly57*L[ |RVI2nq32T ~J]$I8*!H"$IpԦ)BKI$⥴rRo'vE;)$Le6fU Ԣ5O'LtEn=ZR;"JoNfDRH`I'BoqD@R=JҞBqM$OcEf{pV):^w)(S)L4* 2I9v⁎OX<>5?Fꓢ-] I<'9.4Ksu1>'TZ5LW/u^'j5M9L A?n;jlWf?Grli2+dVJ2GɔKHlt[K@4*WjMPQuw k!bɵ dOSv1cOYOUM 3O.`Xfo>LˣoߙoU³|jfu6p_beo ׸]?D6Ne2Zm6EmO[UUXC[cÓSYcL5Ҫ̯"x~$hӿV~O'$];W֞>^6;m׻q.Op],([aIYX<{tEG'Vˈ'Cv$JK*1+qszg=?4 ٌ٥jg?ob7Hkޓa{GjɫVj1XԂIe#Ր0<}k75F::ƍh?{/(.}RSoF,!ˈ f5WGwX{va k[mVjaPt}䞠Xj^I ?rix'|G~EѽAނvZ=oQ\O"K+^i?C^^݊e}ua'yn?SϧEG 5q?^z5 W -jVØ7< 8P_xD"T<< Zu .Kw8l;wo/ rvM]cݷ߳WrhsClZ&}aq@CIogLͤg{O[wˈvwSeMl8<ޝ7k<zYá_,c]5ߠ7ڛ+G)# AÜj>֪g̷\ O}8It빁h;Y7څ٬T)ha4o?3Ժs+ƧgF؆mȷtx[;o&~`{MB' k/S*?bnsx7{I[k6Ѫ.|>KoUIm%`se4I6Nʑ[[샳M'Eq!F넱NK!oy5BDwP7Ne#זzGlW(M.矠w:0z{ߐ6@?==2d zZh;~qP8Mϟ9Ox? j\,84؊n}Aȭs[Omn}/Qg!XLkޮUVn`-!}VZl[o _?t/gVqTưYDk[3ÌJ2~yԏ) uw"Huhŝ>r{l7Woʎ>p cY0m'+Y=s;^9L\\gOKQ꾻N*ケ[47Ԟ֚milւ&u_@ ٸ}O3Tԣ :1,k}}'g{-Uۃ~MrBc7]g]'OgJ6klsmUonm^}o?:j3ٶmO)f.N`8Th2A$ė.seFqjnE1͛C=BkvYٙ7kI^X>T'}MӽZ8tc]\j麿uFL:q(Զ̆tfbH-2@dQgG>ۿ ,4eLVS[,n%zXe 8C}ߙ"73YS\h W~ofOsh{Fpb&Mu@ĄZ7ٿhn3?9Kr?Sd6:~,_v_cx%`8gOSۏChwK_"7?O>=] 'k3lnӰV%}uzmOJ/ݑG ɫxoX7Qƭյιۜuy!G ][O.W_**Ss?C/?Q8( ֝ _w~ۭGqOdՓeUaV+ed6-Z}'665 XZô*x lh;ן߹^ͥ0Or;^(ޭDp;vz5aشt&-xdKK߿l-)n~xѱwK?]hisvlb=$t? N֛~k\^A>, 07!ưo ,j{W77=7#okD[mL]k2w=ٳ֎&?Kgp-&xc=v\浕߼F8;5V;T\4z7I}6sA~/<]g3MVm!wzo?B=Z[ےSWD?[? T}BFD)vjHܤ̆"3'涠dw+IuSޛF<85}7[~agd]:4<鹟Gm7Cwe`ck9w_Ue9ҭƏcvoN͖(D]i&xAyu&03"ֆ&f|-0H @Lk3_mih ~~re]57=OҦPuxN8kf=zmG!k\=&{ Ɱ0;%j*ݟQ{(dL)sZ i%nNn4:L?HBw=ʭ&m2am~b%GI?^nt"QP@Dc-Kj ra#,v4A_SJb\{N9C}̹~moa;k 01+@יH^X7Ols,ǭV׹xwf#}dI ѻ{զOYR <KG  /KcN?Ck'SY^%Hh k| >_ Nִ|=Շpt5(=+Cz;I""=&]I'FxcnYuGie(Nm@n Rh. !#qY,f{|I>Dp9P)y~+Uz5wg9ͬK>{R{N}%ZN[wMSwsNXOOk%~nys;lX`@ (ht5WTW_OU>KGKluϟ..eh&udk$!@ITvRuJ6tӮDʖ3c4T.?j;vS6 :7ٙC`j|A ^\ 0i.["O~5Td:zQߑMk-^Ah+Ck0#p1+D{AO.Z LLjPp&ZTx G(l.GqB׌}-L4Hr# g@5(j0ڟjQsDOscRCcH ];+hM@dY'I/&&|HU1^lPT}ISnU9 +LrDc:ٜ&Q/0Oc@I.EI$tIK$I$I)I$IIJI$I$R$IIKI&N%)$I2t)I'I2t)I$I$eܒI%FzrOeYIs*.%|&N 'o:Rh1LxL5AIy{["O%"" L<%҉Q)ʉFn)-Hwqf4_-A?D:'QD3BA4NYűR;NDAhyL4>?4B U T-Q`,ݸq&u-=!?VZe"~TXBCsJ`dhgv*Mw YZ`AL%$*G ˪sI%t%A4J6DT*B8[#I ZѴ.S[ߣ{c%$%IDX pPN9EjIth)GITSL92x1M J3mНuM lnR$Ɖ'HE:JY1RL0h:'*#TN$$)" L"uI-$I$RyI1LM)!tTI'L*]2ttN92QIHkdJcM#)`BiR<(HPN6R*}5k>+G |t<㶧>JX~kO :S-: aϭCk(dI[R$/m@UH.F-#C :}%jNQE04@ )?a!Q@䠸(LTw_) OV%1'Q%LrD Ӄ bfBJ[d !;A| kϒR$tIIT(GL(!Žʓ(`%Gu!Sj2yq)9Ñ(8~Tܘ7R A "x8 u:jh5_RD1ogG3?_1@G'j\ 'en/ [_롗v०8H6C&Go:&s'ҍڝSĤ؂uq@(c~w_(NqKӎ!>O!.JJF_{w("/L$k㮾GQӴw_ԇƺ(HL> ?@p"Z`LE>$u:>Q\RS8ħTdHHвf杚y?_?__UhNrr[:x,`-Vu6ݓ?؍ӟQMiڣK=KD46KH(!7Ko0/e9);o4h 7+JaQۺ >il)I'(y }2솹$ih9!;X5<"!6L("[1dz.d'R&9Omt5Dv$#Al!{d~q}M V 'Y:Ub5~*R:4IMǼ$-YǍ]ʳ>`C5W4<# 4B|E{k9 g}5N9&OE>`Fؒ"cmqGS.L&?rb6ĽOTnhhq/!n;QC(kvZ~bkIߡÏYnA-c\c@Ukd!ov$A%j1ONw7a&?/&R䱠]m{C !ſɳ܂`ZK u[{p6ZŴV!ڷ4hoTGh?m@vc;iI9 IR"ʚ}= ?9Wh.qﯚJB9};Ɯ#4{ӰLdN2Vm5~jnǴD-\BA8Aʯ6,?"MSh5E5> n8Q'h0KtXDy v%?* M{dm&Z[Ӆ*HL?yO-cu!ESQ3v?jkOL.A-Dzz+7yH>B!IsH)s,#~de{{DztV"9 k@n#G}"mTAnʵտ>pmMb諹I$s;i[vw`EL!zS0Idʍᥭ%IEVd@vkd/[@YaK,FvT-DINk{IOuIaݡ=싞'sСO<'jZ@C"˘AɝcR6Ԣ1!Zfnc"SazVY9HE5[>2dFZͬZ3zm-wTָn\* zD@OdG3%iUpZ7'Vu訄_!p\KcV+[Y^qwW( _>BCEssH}*vǏ~ gq|CZ O૶d5YmS/@8";Imaiuw} `xiwF˿Ց #(gQq:|?u1HIf^Wmniۡ~H99p3"f; n%8l-ĈX3Eꅍ$c):6 BA|\Go 0ݠAխ6 ms].G6Ԩ:?Wc Ug<ky$4O! !nYk|xniB P aO1E9d0YF| ,_#0lRc 4" bq族s{U9%cv*Ӫz, @%<ʪl.?VÄ*&[-o%TK7qxC$ʦ'TPkb[Nǂϸ-[]tG*:8j2\]4m~:KEƾ w"Ca΁PCeA^OY;i B)vL$HXtHf{\Z'ihGUo664AOUOnj! w1`i-ptW!buDt5 OM-p-sL髮:oю踬/_C먞͌8]֏"R0s/Q07~Yo[JMn+~ʴ|OK GԽoK+iOUX&sd*4We]v|VoMZf =tAedWeQ V6QI&>FVOPfsCmG-MP?7VOlQ1@M]`enU\dʰY&Ɲ$)L*$%l#TI4C}$T#B]nDV#,`Mc O  <$_ PR,jIRL HEݍ}?#ZcQ?GT[Am5o +< JD]FO|'q!2:I"hltl`]8qYtU֏?9ttӴV\bͩTy,/;A*'M]{Gc2QˣKݸYnփ(lhĔ7\CgTpmiKwF*nEOPeFwE%/Swd-mhDlI+}{<3 JJUr qM8T-%E &c{(c6^gXOX9'RН5IJ\>yEqkn5@' tQߥhɷȦp.pq(5cQJe[AbT*'l1|PIs09'l4r"k=& \yF|K,Qn=6S !B۸;u*40jQth>1񄥲쉍lqX@lhS4ABL{eVd(uQ"Sy:I+TG)a{ZԫŸkO8HI4Jc`S @ çU$ tJ]$I<&!J I$`TTI'.>WAS/Jh{{'F_ަ4az!ʼS[<~gW#S9ۜ<kI՞G'W3ԲQٿ5a\Nm wDf{s)k7ğ˵즖΄"gT,ٴZO_L9Khqiwڜ(47浟{?ᾅIl)n J uГ_ȂORS+*76\kg}HGޓ6+\]Q/ `?sFN:<5q6C6Ē\i=BW9L=g}kֶC$J uelcY]@~|ZY}^XY[uK_T)}${eu}?UbZsZ0(=eM=?Ruo{\[<+g36R{vx +FCi{H k}o&dU,ֱ-duG=JF0#l:Z7Yc}jU-~-w3WSbځ wzL&ֲZu3wDzCd~w5#T8vKw"84Inݻ2l لoX @۲z-F5ٻnד \,EcOPĂO{Y[N J,grKL=ߣV +$;Glte F͊F[Z-k`lD{l=Ƶs w?8[vGSqh g[ƣ`_ciwv,h,"kv4{n? U\KD{c^m$6@b3$QK[ԟUܩz{@lY n/p#wZBVåo=_cq$Kh.&:PËFj-ji[HSz)ᛏԫf7l\Xc*m{bZُ[i&l{#-U\Z3xk[[YEf? `<NM͠Oޛ\L2g IyvJj"[.cվ_S$5sz?J6fvYۊl>vYoӳ'+s~"{Zw5ԞJgf=n;2CZf DkF%I+]ᵷmoޟ"Pq=vי,h^q:==&e80 :ϳo?1Su7ָY{l "l͢-\)>?Ek}-";QsLB[J,?ZVrZՃSIqHw5EF1gw}5V. Cʋ,smw9\S+@:u20;~c=ަkýhFWߘ4 W8yCq,wbV^Ѵmnֿha(:Lzau- EkAeu Zy{z6?Neb)_Zk-_li ճtkGC~~ ks@m؞9p֓w(&mՑRҩ+A獡{ FĭH1 ,oY=O25U~λ qG7]`C ׳Ee{XK~kt>nE k1R;-Vp;MW?of|Jm^xYmV+Su$7̣}O_R}@F־6 w鱞UYmGeEn2OkU9O iz_qZ[YHP Z͉Y%C]X`; uVhf>J/Knuܡ浟J ߤ=:ua1흮 47e{}~]kVKx\ad7?J~"XY,iwX3oT0Vyݳ64'4H!ğ=ɷs'_MwNG<]H;mi^~&1gzO1<ӊx3u[g~٥T;\SӫߧC>=g:gҩ`ݮ>[gE6khŬC0$D&~Al[@9#5 k0uLo_K1v>ebmmvH0[ OPo{HKk"?*;{q;kb=f}k>Hڇu']3|F!Jdֶ]6lU]c$o9uVzk>qm.;gޭЫKŵlsY~ܚYUm{?4{7Pmܶ0??QrJkǸܺ k)] 'M{tKcWok:mm.\ZMkCۓ0YUbEE?{MVS0a?{?"NLRs{= 8mFZ5/1 cC<<%nI 3Ao2:nK/ulvmبt8= CKlUxvtnpo~8* 9hQX^@_ik$%ccY!dh۱{ɗtlFl`*}ꍙnh0C}Vhu8_NsZ[\\'=MY$i?~wH6!NYNǒXA7Mc%?4}?Dx-E}/w?@cu e~̳x {_[st45,V؊+sm"cݣ?g?[u=>c?Bpzgamfө=wo3Hp@JLNʝmQXmemsDZF}ۿã}^k,ȧp7we7]66RvA'm_ Us}A?gDv=ӨuU+67H.妧3Ι2[mTXr.h6g] ;\_>dH(\ݗX'Ȣ=v4Q zub-kOZ͡9p͉]YyNf7U)|FښCXq9uC:xAnd%F/uڝ4GP:m>4 &`Վ+͔7(cWmָd^0$5yQ1ϳF&?鬯o8Mp 10c47~2\8Ո6No蟼?@c Zi.>(unqP4g?m`5':FGjܕE7$Tݻu'Xos'@N+Tjِi; Ll!'8_3 (6>]YFFI!5tdV9+`2viwg[cr i* $\M IC,]w^6&L)^YmB'ų"H$/p@3^gֶFbzk[BV6 _d(=-7}?Q~̣yCmpر~}[]dzբ7m_mwCq{J\u:|P칕Ol*N|ꢲY8@N^;j L4K..:';UJ`:$$ȟ"VA3UI3P6-c?I )1 r0}WK+aNzFmhN?ЙXxvJ%.t_1M%PkǸ>lnъϏN4vS<vm!Hy_' ~=Ne;l p0G??DKY%$=ơ!&XJ)II(Lh)R?lkT)}e UAUl a#Z(͸* 2͢#᪘PuAou N!N*ƈՄJnnVw):μ|TPE|!>(h\<?$10[*:$Dh"e2JSL)4F%2JYH( )yEff5V'QOKpFXĥ0D ~?]0]c%$5ڧk|Q;BZЪd4#tE|JbIQg,BuS?cw 8=))\>))“4h]SD#c)QO)OD*$H_O?Q''<'HkN>rrU2u_i`) ~ Ni uvP`O,%Cb&%Sv QǁeWee9_eAAHMPvj jsDʛsni&O08= k|Ԫ$<QZ楻g8PZ q|J!2U^;6LTIqIWlKVɝ8o>H?yG l L66Ff>~Ǘ4I6&jOVIE:0eM闺^KI݇ƶ\\Kh}=%]r`I Y$_ O _ha6Ԭ^͘ {V6=Ęd^ܺn wrao hx$Gk02vª;ւHЁ]q< PLvG )2INkCHHjC%¶IF8nn:ʋCf)5݊7tH_);h SI>̻fd wgQ%qpp.iqa"Ag> ۋca̱\@iC]9:摧>#Dm:@ЩDyJ!9HDŽ;AC3,2[T\4:}SaƭxxfwlbKvôЩ a8qDQ} <;E5۸1v1:| ^o-K;چsZ"1~7hY EeNn?qQh:6|gI"ӗcn|PD{m:_ڃxҲ\όhnZGbA1(vĻ YTZe1#IfY*nlw)YO(5e%mGg MN̶XHcJypLy*AGo@sd*bٰQ\v\@3Ulhe}8 BZt$kn"l!Od-p"|P2s6Y6#+hoNk%;Von8d[{QG ;t}97yx7Pm{A{ Xx-W%i/!5G{xuѱٽ;5P, 0V #Qa8t ,quk[t'Qf}&#Euו 6ƇW*` G>q{$]Epa.?Es8%Vg4#04dYga%&{G?BƑ^7j{%vCevȟV@g?T$DV'BdkBkooF فUĶ,|ƇkBv3R Nldpy$SQݐHГǂFCn5< $U9: Uw,;u24XѬBfKǁbf$"U[A9U5{~%: DN.ϻ1kkAٗ7=m5Zhy:" 5W6H3A.̣";Ҝ qlF]3!I~5I41ļ}?wz;gqKDow0%3dS !߻i0YKmh4ܳjr2 }Za6! W1?aڀfy9IհCX}Pu4po /5i GS黮nU$oÍQ&;!of(GRu{+s_XdGtKiU22 f p?Ca?slm.$?5X|MW2*gJ5F?Gbp{wmnԈt-lyG*ooGv$}zO+ы]ֈ*3Jb0s/Q0;CWV.#~ʴ|OKGԽg q?/ R'¤ ':e/ln[۔BpS~%'cS._[? ~^<>bK7S{mӨ,\@2cZ?ܹ5pҝ_2}#ONΒ|xy+ۓ'E].d#̠Kxubw,q, h`#0N?(RuJ׆wdcDa%{Plq`Cyg$~2K߸+A:c̵Vu: >B;,r[xxIC;ZA2ymlox OC"uZ>ʛ @WzMt|Tn Iɐ{]nKt65iZZRݺ*ؠ;o ko4EĎޠn0uG{\mB\_=Ĵ0Hs0|Ԝf(XpQ pd3}0](NNv04>ȉ> yP\;YAIY{, b~@~( &A#>H,;'R~(4n:h]5VPx(Yt$ /oxݘCǠi[=#CG ruؐNZ̅`L$JDoĝ-Tl4|e H<+.=-y:8~i()e3D))B۔ý'QL +SIr2&5ݥ&ٳȵ +I$C :Mn#UrL48Tvۜw&m!/q`;ChAť&'q'^[ ٫GTX겜v{UU;1C04wPMF64lݿvCc͖ ZʫcOoB5Nx+:?NI-ig0:i?Sg&]mƍu9-;eOn=7} ([8`f?X6{\Z٭Aw{j=b4P6C8n cgEm$78GӳjH '[$lJk]d[.-ݤ}ߧ l;cgc3o57]e66V_0X=[vno6>+']JWI,l'TۻYIj}GVZI]los3j]=x|V'?W˽۩s/ͪRmu[K\\=52OXXWM@|;g h̲SK/%6{gW4ßaq&މ`hLx %d!:?l@k`&uF3iދX!@fQO7 ujcwփ<Yw=.gֽNSE_S-jMVGв?~_=;lv[ݺv{4G`h1BNASO >4vQ_F`nYtumkNq߻zdm[PP %ww{_u!tcONƏԬpv0R` FySWKD@OI_X w?J(z{Xsهzkw_5~֛Hy=mwfҡmcEvKL~s2Q)d{;Ao?Fmu8F6~7w&HPd8z9f\ׂu>?8e氚c1{D;qa;w~yn-Rڛ/pok>́nvC4Km?m6+tٻhۺ3ꥯ!1K{-I$ ?Us@Ҩ~=z3v|q:wr2?hkk.~/Qh`t9RþU_.O"ll2Nc=YBjf&9u`0<[ٳd@;ĺm kÀutbL{u:qG5R` kkl{r}Z8 _D4vZ6Mvȱ.б茌펰xcNUi OV2=:ϸl~4* 5Q[?S#t39}1]fݜퟙ8oQC^/$~O- FgQ˪uN6'n^PA qm<e"yN=gь3\ڟR5q田v2_mQn}b1"+U}웁5;WM3%P'nG?XuF@oB] l׍ D>Pl&5q߾>=cVKGm{"\el}e{?G=vܗ 2wg e()~YlImhnwǭ}1Eu~M+},>p(U65.q7K({F5OC'{kHURigøҰ;wmWzMn$R qMLg}?k73>c)y;mFO7=ބ+3/0usFPU[ys[LO `h :zo V+ Xnhٍ7'eӕUmhuns*=hX>Y88rx} \u(M='#Ĕٔ:e6H$k֭e-hN4Z\1Uzy#ݩ|LOɩ̨ծ?{ZyAO4z~yne@;'!c5-(/~のW=y.=h4o< <|ku421mqf[bhe~4ceC=D?&V̑u#fT$ NuV^J}A A7NjWm3e%A%Wʽ2 gJSyÀLj@g^Нy+G(/^&UU1 AA4<Z*N hIts;}@tĦNYwA!{ws Ǘp<'~3c&;;9Rk pG$pӰSpǗ$/U.I A67c55qP+F( /r.qog;othDN,j1.<􏫿W[.P zhw?7IrT )*MkBFS?L5)buPut {R '^wjya/?)HŒmdSODZqϊI_y> |S#Qtƿ񐳖y,23`iT$EI$I$JRI$I$I&I$R$I$%.d&N%)$I2t)I$I$I$T~z+?@Doh.|اۡL2N<&aB)6FjGI!dEnQ@Cnߟ֖gq%b)~NHgOj']>>^S~?VDP& 8"cSvQ3L;y|}%,yLL`ȆݣS8>j 0fL)8?:H袦w5`)#*DHTZ[ YΝ i$_kA_̦>) *:KH\yS4BC6J_%%)ƩGtiISA)I(Lȏ)RI%?znS@)uIRJ;gޚ')[KOCDAu wDDVx4JJ -<BR܇8R18G@rp)[1k R !GCTK^5*60RB:dGKxqJ8K]:7Y zdS#hRQN;Ag1OdͽQ[D! 3-ԇ|i1Hc%"@Oz`(IBq8pIV/:ZN묳RJX3@hfCzSErԟVjc(Y7)Iq?R!;hHUef *܄;tDmHU^).4&ܛrM;88aA^M1pJ ?jup##2LhmDxS8^cOH ~ |a&#LpO'9tHywN9L B$LJ%#qDt? HLx)?D@$~P?%'ߑ@GyNB@?N$9'̭I PpЁܦ4 %E @LfH_y_QI<?>'J;L3ǚHX駇P'w_R.|_(x$4J~)Npijy?IǸ_aQ_HRTM#悗$A]|475h~}/3ɒ~RySQSi)`IZڍGBtiХξj@m$,t>3c#FG9:q^t_%`fdǑ(kdzӣtH1|Tߣ=#`Ysiq݃Um]Y{p?Re>'W=68<4Rhw`^ہ⋛)[^+u pǏu\q?*k;IeƖ!%sDH;(XSTbLG 4zo{(jO`lt{}H¦ $&5Pi/3A:꜕`m4cbLmv GM@J>$?~#Jק#)xNh e 58[_Ua/$^7@t%Mڝ#y$wz yws7Hv\HΉ 8,{}UZ<S^PNĔ ;xNe}464׹Shk2hآ*о=YJSd9c`Vj|*[( J7pP^ `4OIa1Ͳ@x#oN$k0ZF q?Wga?қr'󿲠ܒY[>dx$X̎90 "ٍccMEcv ʹ ŧ@ޫm OႨ$J_sXFR΃Ik A@ I0G>B 'U6[{M~:44s=Hc@=#FEk@;c]_HDŽ H'ikxT*L(n;gwI~jzC=Ρ]$ x=P{c?5iaNkqh:cJ~6NBȤ i j`?GR<W̗8I<Scc(:lF6h6gդ0 N2]։6˧@4\,}S\ +w|| '(8 68sgQ_%ԟY8{\HwoV1c I2\HF F"4";r7"J M؞ ̑'_U~:pb`ۜwF?B~< tŠ;ӔIctv8*n7*וr20yV.GJ~ 9#g^L]P}RuD%IjvMcNnߤG^kV<7'C_YO?m Ѵzʴ́"6{Z [exCqSOQ <|e- xIr}y6 itkJk?\kkUk wm@9佢 ?U,8oV=d`tҵ7즹ɑZscTsaeCxV^;*uHgIJ豍`'N)cIc@-Rkln abfCR5\8v҇ڏ!{^XA+k38妿>ʔ|]RA Cꐞ@wKԪW=!nq˘O}U$fReH0qߋaTJmZ%IA je>J>La+RI% I+Ɨ u5f|uD#kbw+$\) { Kb{o֖ XtI)Xʒcnd!BThhN-I$OY&-խ$PK̸ϒNwW idIRLQShH,QpRy$ЈlZI$$LL"5D NᵦTLJ-Wa2'+ox|[r[e~HHnfR,ʴ U@M) `ٵbs<'?&R$7q!>Lv**AЎ>j!Un3wm;9}ҳƱh$*Єݟﭬn 0@xςm;gyQD!!JHp^)3i2lA%[4:!*Q%iի B+uߤx8FvqDi,hI4 q=0I>$+(L{N ;'GhUg<zC*I9pNRMv4ݽA֏f{g]cMPxD¶$:~Ix)EdIiiC`ôQhiKZfh`WwIL\ߣǁME{}DT ]cNSYn_ۼ"n4 L`-w!@VgdO$K"GPkn+h>I:ӿF $@Mz{'}QRai/- 8=r[[_!EopxL|$hkiUK\>mN˅V?di3QPn= 4v 5[.o;u|dO*w:,q,!t(Y ^ߚ®se 2%I$ȸdz;voާD5ໂ&)MY"1q{(͖Gl 5 P$36@ føL6orԒ@Jٵ9[AobH꒔O[@;nISJn쒔A$8S3osOc['!6LR]RIRR l9%z dK: E!yjvQO4p@TX>ώ]?QlSu-Sw3k `Iۛ%mkAp[o؂cIvnюSk)^\'DoCh&<fKjF$i~P@ v2nиLJ*_6{xn>=ct3[Hi8?╿P9hwῙTmk.7tkF{!@ӁcYd1]^v1=E;ːCW ׶}8I΁jo&ie76lkw1?~10wW]*K??.z $@`7Q{NFG%]Ͱnh|'HǑ^ǸޯvߒŞs)2Z>n_m]n0,{ [#bqBƉ-'@4k%gU>ZƸWvm_QWfgu*EMx y)txvWO$hu43:Yw7l@ZX嗢F۱zmhSTprCfo% SKu,- !wWͬ>klژԮ TN\iUk8)XJ|~SZX=3ڀ_k7 >f5PA;\ݿ*ԯ/.nw=~w9s6@q go:5]=PYLHw>i?|O=TA[-6v6zzVg3߽cs\ao?hOkTaNkN܇~b+뮷7R=: !ڵ=UhlSeOr]eL0ɓO!]QkAy~EM~kuEk]4Zۮce?lV,Rьֹ0W<үk:~X4GpӪϹGiL͉ki#ID`q:{DT[M wO)zq0ڷm"^6[ِZ1>g{^+l*[wM Y/UkqjnKEx9{Y,")wϷ_Ю/S;%][f+k}^x'rMb56M>T G#XV7Q8llc5n6jnVaK$AcaUU[͖\ޮ9} }=_VnȽ.OٳއmoqhV VqAeb HAq #F?LG}a}NDy㝖i/y ?G'Z˳#wRe6\'B=~ד{5^AcHە?~8 6;7~ݕW]K5 |X2ߗCtخi.&c]eYum;COQ+U%3>9ysZt=&C$.w5Qϰl/m@6ڲYv;CooS* wY ߒv!:ZԱ5}t; UMy>FXPNvSn7KHϣo,l=.yð{Xh$DKi]*ZbCX\l>&}o_,i5}oqlKct RIP͐(gp?"G]TVU47ecwG\ܚ|EaN?m_VW[>vS=,vuL0*oҷon_ګ04Ln7/š6?T NrCZD{Hִ6 Um2͟Yv{Iqֻ%,s;-F6R~}oO\h,,.wOQ?op $Aߔt<$-GiL%6#%O=jC/N0 \oψUzl@!nw_h̒5zu6NjB2NN?]ߞmk -W9.V7u4x!xcF8'_MJN{vNeʜ smCǩ_D <:'`=G7ο顿0 /x{]ѣΓ{)5_4zԴ4m j5AeY{Hk@Hln;ٝ"V] mki5uͦ{ߐ`sMntip{~ <,p6Z{[`u_Y(6ޫShy F*ّٖHZ;M~Kf9Pf#hi-$?mNI;{K} 6O>jܷ~82 =uہ`ԲֶX?9Vkq浾փa;Yc.N~N=s*nsZz];+7;c?C> \^$~jEx40)ic"gmηUjو lsE Z s|6{߸:m6xkI0oAme=@V75qUO3@Rmbl#Bxy5Xq|jza M$['K5#5c O]%VBo$,Ymn{ }"OrXX@kgU RI}d9?'E[C;>ɰ @i,ogݙv7J..ӳb60Y 4LI@̨Ws],."DC$ks]$i=GP|HDUxL˝/qWG~{C&3ëk^nOwXV3*:NGGQXc`qC#U-f5kt`?a5ۉqS}=4ik{G ݷ 3Kز ~͹Nl ۿVB\O䃯~h=plPMmO([Y5]uVk:vATyeIcvp+ҳbLZK}{氃-{7/>]x[{d{w_O~K2$$8uEFh? Qyv8jݱ= -%Hjimqbf5l:H#aZXuDX7#sz)~}%&jXy̕ +o':nvi"zr5ss}鵰o\Zpko _6uX6c O>׿誇s$HG0RמfQ]!BC !as>(JMИh+-D˛63GP]PwqM~bҭf)l Nީ)0I.?gx"IQ1 ;@BƝ#MԱv(E%4[a`ck%ޑ3Vfl9>~Ee {&Om/;M;W[9G5bՠ}S'm sT,3LMqjxw짷&IH)̭0,{4yw>԰:;HW sgGLdǃQ@40K*!qA$<5>iAYf[d_!ޝ|ʶPuױAUthRa?7%nȦO$$Hi,a/{U{[׏&uFQ{=Ny{5|R n%G<)hzBl|vPkԡ<CwZ8kG'M-Gvj Qk7#'m`@[knIjb Z۶13|Ys1^\d?!d ?PӿuOehd)ap9~\_Rɻv]'|70{j:W?cj`?@wԬ:uScU{߱m6 8UlfcPD"4%1?DzP0qcODh6.O!)H <Ȏ.>?OOExt%P؏QXDpG|3IsgoOI4H~ 1)HG%is)M#_&"T02qhKx1S!tʐJ )t$4KRӪ\(qC⒗:SrR&>iAp3JPO)D!9)!tH$ IK'LR&yO&"Q]2t'$I BR{$LXK"dK)C#BP'BU %XGesdjВ)0TrRQ#JgP]'dN\0Tmx)JkDƠ zAʮ*HWk`F2mU?->)4%ɋnBޑr(h Ω!!eɦ4B"G9hI)7O Bm{~ S>ԔTw(JiP  "8H $g"{$Lhq3H7p$>I$Ⱥ~-OQ$Qj'^yBr5Ⱥ)PzR:Ŧ&N'`Bf{X|[Rr?ruD0pƟWO$O?_PHqw R%,_Ў|jȝfx_O”j*A%*Ԏ- {ci;"A<~0$Ծ*MhBB \l4$@X\t#?T@FHOF9ɱ3}??U1 *XũIkF(?HTD!2m,;v0ڠ(~T d8MpA ~a'}ΛGɨѐKwޘ:e3_NvDĝu1C! \fGjˏ:c#sE}SU&S4P{ o? 'Oܦ]M5 HEzqօ]NK)Qq'F|<<Zsp}-X } G!\wXskmy@щTxw(& F}N{H@hn#T&΃npH wr=:ͺDVO|$Ru(C.JզGe k3v?= 310uI&' 9\}kZ105[jI%چwӟs S5I-~&L$+.2N <s ٨;B ch0'G owIP`hr1|*oh'h$FuU6I79΀>ByCHyI>+H# \}&OZ Qm{Ɠ9;sf?q9.:v'?+`tr4jj]Mm{C)n LS4ݫ]׷o"bna|I-NF:qF5۴'e"~*"oq8^ajEuX;eù44DrKWq I 'VCE0gkѪqAثU]@9&ljMUlL?袡)G%H3n>(ZP"?IԲ$ R-sX?K_V⸉h5~Pun?{R< i}ɽ5x/rHՋr'IՈSZ65(!Dđ_P􌁠q4w~~fVDz@L)n;!X\\KN=a{yJ'0?IzdHt˵% :7|"$i0eWuB<=/N Sb@ZT jt 7Rڟk8?PW.ӰR{ zH!7 +X!5p /&F˷CǼijf +8Cf3BNE$ɱrEar|AR695ɚq1z˴'SQq;RVKC <'@B@e ւǗeYL̓O?Rlh-m49? f hBJH~@xpnd{xX܆ڪ1Jn$馃*}o5ǐE֍k{dHd<&>6߲Փ.*;I:?j}$F+vH$ 4Ocq$!@ݽZ|H 0@G1oq먇.aB[(MڑRx'*Alx_FǸd>?JSyOX`> 3?V{En;ϚHڲ+/nOma=]KD?ީCFgO0N V)>'U48xꛫ$3%j>-Ǵg_&Z6:x{jk?L鮃}R9F=H4?K+ Zv5{4(ىSNs}Lpn un+$'N"&H jbU\0<?ŧiiZ`l2Q k{uJxgZuiDl8@wTnŸ[ L#2+~ 8pׂّIE%*֗b걿H{Z﹇B$ ӿtg{珄TLk-wGe&C=Im'2{"?LLv-{ANU [?K6~jxħs@Ыt\K`x4B&d8Lq@~rrXfA;=&0k5ƪc}'ƦtRJ⏨~0I[ ]>(yT}1=49(IdO]CC24:(Dճv;2ZB,\x@>i,`q=vV ;"H<$A* 2{HdᨰTX 7\#W/e~[w>k; T 굇GL"8JoKGo@ ~tn  s_1 7o% KLChefË}<s5gW}$#P_R ^z@Zc~z9v8Y r+Zd>ޝEB^'A=0'롃qGp[_T**Cf0vDl9L1wL}u7:td3.a r2\uf߉ xw=wXu-^yG(y蟂εè@~Eo%:*aY(v&*N{<,4tr?XX'P}PORl?P#"kXyu!ʟYr m8LFB5H0A>ZНLo;Di?r ZD Rc!}.p{vN1vLƉLK,kJMae>L7}JbITOGڴwD&akS($5dͶ aV fR.n;w0m>ݰ#1 wn!@)psqS&;۽X9G a6v.a=֗S;=5A'fOV6yDRT+>խJW\]xl1ih60juVFko@`Yrli#:+LNOJ n۶yc! DD!Sz`À^XfG` D0l-nϙV-W^`(ӯh2DJ:p.c4_tj;#i޹r]ɱϢ|NgtCk+YQ8pP;H׎S'ILJ nPwa 0^$$dZ}JD&0{)R qky*nKROT;mWwS II@8ӫNFPvbhO\mJ*E IFn+ pl:8 <@mCiИvAw'D$i:gNp?7{)"Juu-W RkcU( #$'I$N|G(CqI0')R?TI*`4=HI&;tJz5tI(*u6uEҲ$${w  УRT{:HڲU%qO1_ڝA2kWpG۬0$%9+-f[Mmh.Ce=U¬_pnޯg˝n q*!!čkOj!d,jH'uN ytOrG*ïun~l6~3m^occG?CC'z AGs|NqENǣ~LiƮwِiA?+Z*ֶ@лJOkK h@yywCkYqfqZ6h`YO5w ǿ0Za%̮gD*l^+kӖ^}?ѧjdp[벃\@or->D?hF#ZԷKtk3p `kw']|2qy[ssY[?Ӫ(9?m>[dW }W׻3ThõỦ;MbqxSumy tMNP:^̙.\ؑOΗ ? Pve^ZإZ6>PƷ{|wg9 AX?N?¬84;f]?yWc k۵;1UV6 iddbĿc>?U? [2k+wglmhdf׉smbk}?zUٿ{?H5ېcX\C\o~{?OwCįk[ߤ{~5 ֘A:_Mi{񆌏w7[?g 5m7Goz\anmuֳ?1*} ٛ{g zjXWQt@gm7*g^?!s\D@iќÿ2/ @%43y  eײXϱ6~hg-=g]*M!ϫň&P9sZX1@,ii.|c_c춘}#+F]IN , ݴd '}@%&5x3[Hlc*n=c1 F?m[=GlS/,-cC[;𞚩Rpq _n'"{"Pk@Zѧur.xQskk=:7c=m3hSm[SOa~=}?ZގC)%w~f?Wrkm9iٮ=(7ن A_Iﰋ= vŃiq<12V/g78ʶVQ[wh^q:+ip8@s>*g>Ws݌wi[g?Zni&[iu1xfaݬMXQ cƍ7}~o-/Xh'/l$t9zXe(!ѱn 2lmsX>MSgDi6o? G5txkl+.ݳA6׿Rҝkjc]cWWǿ&{eȻzE +@ʫq cq]8pcH'-)MrOƹ-$M~+8FWhhSÃ7Z*3jI4;]>E{1:A61˾3?Y=4AS[H/p ɺ{˜?$ Pcf:k$pi-U:Y}Lfޠ '} s>EO7dO^nM?Z,G]ދhk:-y}k'mN&evo/}5 #Aήf406Zv6lO6k[\ X^Csdn3;өI8]dK el6w*YmCfkYB ;\lq.~G5d6|U]h|}Csг~Ff&A@U9FYڱZptv [ޥFC 6ū7cvnݭ[H tudj uEMoxJ%]m$VOXk'DbwaWk[fnh –MZ-SKvX~w~ӌ[K}8edjS_mkZcO-$!!d/-A\=a@Zosrd_qq֒ >=4g?!<^npocovzpoP }mxz5y%ێIaF. =IzU[~?w/Ư{5X ZsjT>}| ;q>S:kkAnCN!ɇY>7z=4 $s)]shnJ"Ryp#gpIq9ġZR!t^+ s?9߾ qq{=c7eCW>W[w@X&Qɳ1GP.uu5ѥs%Q6KiM[ѹRў ղۄֵt~o%fdTYY6fFwsاҩus [ږV%G?vֵzUK[%q~!| *u_2S^|; sY$4hKԞ]Q{w8xkPpu-ah-ԝ?[gQ@ w֖ g4q=ߦ0Li>PMs12m9GL)=5l1IhjO fLm[#+ښfSV+79g7[G؝wP;&0IRkaj_ǹqDl̂lj B{nDv{(h\Nn,x󻄩Bax(*ɭ9'Vj_PY?r|Ƹp[-;\ -G(D]LBC=\ U:ԺL}1Z ss+:*Ohx3<G%wwnw淟Hx@!LNsU)I1X2y*U{MHЫ8#tA"'Y:=ۀv;Fj;Iģv0l+xv:}UZ#A5n!'_514*lnܧsw?wD4v0M^?k-O x]I{> .1 B5ֆ4UxluwV{GtK,:dLGd[܉YS#s纕[~wZ9O$, 0t#lA뾥[>`QzNDy:V ǭ4.<ʧ+N0vC܀Td"4( AyP^Ds$Fh&+]t:Sc\*Chh{LTfL T )杺J?@#yIL]dy>)u-BU$t*'$DOb9{em ?*^:tʘ#X_Nd|9MJ@iT:ڈ:$h]M*"bp,y}%Ѥq5-&O2ʧQ4E\'V"O$|[|UI$XԒI$I $I$I)I$IIJN:IIJN:II&L2JRI$I$I$*Z(`';M L@k/ ׄV2y=Mg NL:4smJ$gH@ئ0';?b Y$(#Ϸa;s?z ? :a3Ir19Mv> (HL9'N] BGs8K=fO<_ARS=S&L3#8ü'1& JJb|#RQwB6xuT[Sh~05a%=;G8uk}57{D t;O;:B>IA0;%::Otxמ xDwI 8H߂R(IKMȀaDkNN$*H\ADtN%7<'%()F$$HKLFx'IݒR2I gD)AuLLjIi%IDJDuI $ ĄM ƩFS NF$P)&82!PyJ<RJrN #8JT)JtKI '>i$e$LhSJyM)Q''!(ILJ 0) ($)H'opHQ)^S~) I|{HɵɹHR/064) N TLʁ̩nKSx1Dz [(y3LI:!ӔL&:1|@ x}T_XD :'yBcRQ}@ "c\8O'C$i<|L > m|RS]?C=ѬqCsӷ҂ v>}HIJsN}_m:}4S H%@'*'Q08~js2F6iw@gDmEw@I xQ/#Vq'ϺjyO*<önUT:W0;Le1.2C "u(e.nֻs?c +<,Ld9NTK2e Α"I]c XV*avB8}nS COkIi*i\a8PA;χe !^{ZT>Խ @=4gGYFߢ5mHyG> > d0ANƹQ~>ݨxY[r!֌ǗnS8U!?$v+4R1bD'@cbn?ߢR%>: XC$Fۚ_&Osq?jlckn֍8*ŀ6}# ?AQw穲ƍ {';D1mԁkNILA(FH=5yiVj3$Dwْ]@h;HE@sY'ps|TVZ@n]u~n ^ #S?!L35VVZ62䕶 Ib}gH?D䪗PQp{(ͩngG>"23k`kl{MHG $9Q}@^NYj"|"3ӔVeV$??"Uft 4AK*%s}@2@?$a/<9)UfAáT6K_ n'qq1졸z[~IJ<"|vN~OLw0S Đ50O`1gZJ:Z~;#vO#}ES 'Oν0w&W$V$S$xƃ}߉A:Yq%L -6C˜"PqN#k^88Lw0XAei$45X  ]*y0~*DEs6ƾ:N-|x8r KfA2Ihߘ\>=|rѹNdFk"8#1NXZ yCiH"S"#iKlk`\MxE6z$s~ wC`HMX5.PkKFR ğ4Am/8q:O-.m|9vt221ܐ-?~8{ |HD68ʳtX~:*JNI$l[L;hBڸ5d쵶7;&FXnEw x !L!I ul4Hϳ#K=I_u'ƣIE5۔ !ʹX )V?X e'2 usMAQ'M4Th8$T0J1e"uOgZ~3'{Iِ6{,m!ۉP1@T腍diZ¤:L5g}Ud=`oen-Uvh:x`Xt8*NsG̦&8Uli;gÔ ۜǞ:ΙpqZ4hun3!"MHpp]x];r Kp U ˨?Q Y 0"?_H#Dq۷9 mL*A#}7}윧\!i[~pg_~7@[v?U-.iwVt-