ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:36:56  &.(6HH Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?6F'o A Ik|@lv6;|U7n|<︬{gC\ I!Uxu1n<|*: _&$.Cv+:K'?@zCQ̬|컞6+)ۧCn8kEg[s}Q/kݼ03oo[Fe[Զ]K|Deus}eR#ӹ Fjexv>eP٣2~N紆H]۶H:XdQ{jұN-WT)V]0URd%AVu- x|S6Lo;m q-ՖG! pvAAj }?!VbNw?K-t*ۭ}3IonoSo8 Œ?袳scڒI YVMnm[ROswILؤ?]BK^doڂ߮*Uy-i[%bk7n%5?5}ʿ>GPaAleՒv6voˑ1R{[fFW֞Tj<\ 17ֵ_5.iǤSK*h[(u6 cGѩ#9$7NtO i5qmF1݊Kholӿo~ұ<2>?Q6ޥW{-+x?Nv>?4 ֚WWNWVLgMnQ;tnB´X $XX;bU]e- נּY]eK}~.ڱZa#~vcdk=M25>"/2Nɳ״HsZ~͟X~(ms;v㵭u{l}¨ ytP5];Mo3_qe`G7\KxIڧ8nAr+]cxqĩ9H߾Ƴ tZܦܒI%:ٴ}!Z!1[ ^?j̭ʝnԈIM-0'Դwa RncNG$ ~A !DÚ5빪ˇ{L8H)W7R<@$A ;ijM6@?/iwT/'? Fc? &?(*k H?I9RSh I4O"ܪ*H$#wcj|G%7)ɺk\COnc vZRrxsZ11_{yy>9jL2`8$ܚrMA^ 1$6Qfݡ 4Gr?7h5\]0t(y "A`RCv衆'wp5k]0Lh}AQ4~[S-vȖ)MyȀD:yԩmntНR̳]nI?v' ( C'BILC׍G#$ $vt=F|#7<&7~R3sVN@OEv7mɍGxڒOh'@~HKû$@L9$M|Oܤ8;1&%Iyq:ԤyOU\K٨qtasY~ݤ>GW[BY};;vKտ&nvwQ`ɍKovg`1q썏dlms@S~8XX=ԸϢ@?gQݸ~~*99=FǿHTO!p -"mHJ+NJN]#O"!=Yd!O-?襍kxXRSHy"xRHrf^ct4HwοIV&ϓ 䔔ɟO\AEDc9熸x vӵiIMiq,K-<i?5NӮљ /Xןݑݰ`ORRbּnޤGҩxs9?$h$pSy5'1jg㯅6ec:TCG/h?+G>tvҋ;)ɻ=G6E9#Ɛ.N/N®ls|Krdz p"z$-ʁӢEv`(6aoĦO)gX2- T %[\SvxHOARrm; t3K}LHJFSvx}C\B}EY`4{G(gkPtG3rtj=QћkLKvȘºЏpyHK'RvxS7g'GU:K#]q{h'iA/㲕;$??w'Q ׁ$}wOI>gBgxRH)OP=A/7(ߛhϩ"P;/A/Ќ+!z$FN.Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU workbase_foto-27 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM  Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?6F'o A Ik|@lv6;|U7n|<︬{gC\ I!Uxu1n<|*: _&$.Cv+:K'?@zCQ̬|컞6+)ۧCn8kEg[s}Q/kݼ03oo[Fe[Զ]K|Deus}eR#ӹ Fjexv>eP٣2~N紆H]۶H:XdQ{jұN-WT)V]0URd%AVu- x|S6Lo;m q-ՖG! pvAAj }?!VbNw?K-t*ۭ}3IonoSo8 Œ?袳scڒI YVMnm[ROswILؤ?]BK^doڂ߮*Uy-i[%bk7n%5?5}ʿ>GPaAleՒv6voˑ1R{[fFW֞Tj<\ 17ֵ_5.iǤSK*h[(u6 cGѩ#9$7NtO i5qmF1݊Kholӿo~ұ<2>?Q6ޥW{-+x?Nv>?4 ֚WWNWVLgMnQ;tnB´X $XX;bU]e- נּY]eK}~.ڱZa#~vcdk=M25>"/2Nɳ״HsZ~͟X~(ms;v㵭u{l}¨ ytP5];Mo3_qe`G7\KxIڧ8nAr+]cxqĩ9H߾Ƴ tZܦܒI%:ٴ}!Z!1[ ^?j̭ʝnԈIM-0'Դwa RncNG$ ~A !DÚ5빪ˇ{L8H)W7R<@$A ;ijM6@?/iwT/'? Fc? &?(*k H?I9RSh I4O"ܪ*H$#wcj|G%7)ɺk\COnc vZRrxsZ11_{yy>9jL2`8$ܚrMA^ 1$6Qfݡ 4Gr?7h5\]0t(y "A`RCv衆'wp5k]0Lh}AQ4~[S-vȖ)MyȀD:yԩmntНR̳]nI?v' ( C'BILC׍G#$ $vt=F|#7<&7~R3sVN@OEv7mɍGxڒOh'@~HKû$@L9$M|Oܤ8;1&%Iyq:ԤyOU\K٨qtasY~ݤ>GW[BY};;vKտ&nvwQ`ɍKovg`1q썏dlms@S~8XX=ԸϢ@?gQݸ~~*99=FǿHTO!p -"mHJ+NJN]#O"!=Yd!O-?襍kxXRSHy"xRHrf^ct4HwοIV&ϓ 䔔ɟO\AEDc9熸x vӵiIMiq,K-<i?5NӮљ /Xןݑݰ`ORRbּnޤGҩxs9?$h$pSy5'1jg㯅6ec:TCG/h?+G>tvҋ;)ɻ=G6E9#Ɛ.N/N®ls|Krdz p"z$-ʁӢEv`(6aoĦO)gX2- T %[\SvxHOARrm; t3K}LHJFSvx}C\B}EY`4{G(gkPtG3rtj=QћkLKvȘºЏpyHK'RvxS7g'GU:K#]q{h'iA/㲕;$??w'Q ׁ$}wOI>gBgxRH)OP=A/7(ߛhϩ"P;/A/Ќ+!z$FN8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$佞_3%q뤛j[VrKK˿ѳMi%+']$RڳZ?r_r^/{~M-9%i%i%+']$RڳZ?r.FϹ/g=\y?sz&ږ՚lly̕Ǔ?箒mmY-.FϹ/NFϹ/g=\y?sz&ږ՜lly̕Ǔ?箒mmY-NFϹ/NFϹ/g=\y?sz&ږ՜lly̕Ǔ?箒mmY-NFϹ/NFϹ/g=\y?sz&ږ՜lly̕Ǔ?箒mmY-OFϹ/OFϹ/g=\y?sz&ږ՜lly̕Ǔ?箒mmY-/.FϹ/.FϹ/g=\y?sz&ږ՚lly̕Ǔ?箒mmY-NFϹ?gܗd<=tmKjIi~w6}~w6}{l>佞_3%q뤛j[VjKK˿ѳOa%+']$RڳZ_]rFϹ/g=\y?sz&ږ՘=a'ly̕Ǔ?箒mmYi-CrΟ%'']$RڲZ?ͳKFϹ/g=\Ysz&ږՔTgܗCr>/{M-%%Pgܗ3r/{~M-!%Hgܤz#+']$Rڱ[_O6}?6}{jJI6Զtgܠz6}{ily̓œ?箒mmY -oڇ>ߵ]r^/{~M-)%zѳMU>}_3%qd뤛j[VRKXWgܟFϹ/g=\Y?sz&ږՐPl~?!+']$RڲRZǪ r_O6}jly̕œ?箒mmY)-g ,gܟǦ߹c=I\y?sz&ږՄg$gϹ/c+']$RڰR[0gܗ40]{ԕŗ?箒mmX)-v3Nrr?wwM-%r}}>5%qe뤛j[V KRcc>j67C{Qڔ.}%}MX߹9ȁ%0mRMQs.!rG$0kӧ*I([Wjly̕œ?箒mmY)-sϹ/g>=_3%qd뤛j[VBK_FϹ/ڇ>佞_3%qd뤛j[VBK_FϹ1cg܏d,=tmKjIkG6}jly̕œ?箒mmY -oڧ>jly̕œ?箒mmY)-oڧ>ǫ;>佞_3%qd뤛j[VRKXuRKFϹ/g=\Y?sz&ږՒTgܗCr^/{M-%%TgܗSͳK2W_Idjl1>佞_3%qd뤛j[VBKXSroFϹ/g=\Ysz&ږՔll;>佞_3%qd뤛j[VjKOÿѳMe%#']$RڳRZro.FϹ/g=\y?sz&ږ՚lly̓œ?箒mmY-/.FϹ/.FϹ/g=\y?sz&ږ՚lly̑Ǔ?箒mmY-?FϹ/FϹ/g=\y?sz&ږ՘lly̕Ǔ?箒mmY-/.FϹ/.FϹ/g=\y?sz&ږ՚lly̕Ǔ?箒mmY-/.FϹ/.FϹ/g=\y?sz&ږ՚l~w6}{l>佞_3%q뤛j[VjKK˿ѳK˿ѳK2WOIfl>l>佞_3%q뤛j[VjKK˿ѳK˿ѳK2WOIfl>l>佞_3%q뤛j[VjKLugܛ˿ѳK2WOIfl;>l;>佞_3%q뤛j[VbKOÿѳMe%+']$RڳRZ_]r_]r^/{~M-5%e%e%+']$RڳRZC>l;>佞_3%q뤛j[VjKK˿ѳOe%+']$RڳZ_]r_]r^/{~M-5%e%e%+']$RڳRZ_]r_]r^/{~M-5%e%e%+']$RڳRZ_]r_r^/{~M-5%e%e%+']$RڳRZ_]r_]r^/{~M-5%e'ly̕Ǔ?箒mmY-1O]%'']$RڲZrڮFϹ/g=\Ysz&ږՔXl=Y%r+']$RڲZ6}G6}{FϹ/g=\Ysz&ږՖ=a>!՜Gly̕ŗ?箒mmYI-_FϹ/>}_3%qe뤛j[VRKTggܟѳC2WOIdklѳGRWOIe$jlTg܇d,=tmKjIjѳKѳK2W_Ie$j>jly̕œ?箒mmY)-oڧ>U?%+']$RڲRZd|ۙ] I\Ysz&ږՂ9`~k~`X߹/o/]$Rڰ[,~~j!9zw/]%B[kc75RG_%J KHP9Hc~/Ƥ,=J0,@rb=ڇ7K?RM%J>F[O6~ P{佞_3%qe뤛j[VRKWѳOU%+/]$RڲRZ8gܟFϹ/g=\Ysz&ږՒѳKFϹ/g=\Ysz&ږՒl~w6}{& ߘϹg=\Ysz&ږՈqrgܗƤ,=tmKjImr_O;%+/]$RڱR[m>>&cgܗƤ,=tmKjIlO6}ɝ}{g%h;3V߹/c=I\Ysz(Ոl7Qk䗱Ƥ,=J;Rڰ[2}r^/{I&ږՔ=Y%Y!+']$RڲZgܛÿѳK2WOIf$l;>r^/{~M--%a'l̑Ǔ?箒mmYi-C՝r_r^/{~M--%]%]%r'']$RڲZroFϹ/g=\y?sz&ږՖѳKѳK2WOIe$j>Ǫgܗd<=tmKjIjl?%'']$RڲRZߵL6Ϲ#]r-{~M-%%:FϹ1FϹg=\Y?sz&ږՔlw6}{佞_3%qe뤛j[VBK`u3C>佞_3%qe뤛j[V2Khu}{Ǩgܗˏ̕ŗ?箒mmX-Ԉc>ߵ6}{Tp?ͳK2WOIdj;>j;>佞_3%qd뤛j[VJK[ѳKFϹ/g=y?sz&ږՒ=Y>ߵr^/{xM--%`gܟFϹ/g=\Y?sz&ږՔ=\gܑ>佞_3%q뤛j[VZKo}[ =X! q  R1 qoĺJ$BuIVe]$_־ 5h_ϛIC7S5:fITf]$I$IJI$I$RI$$IJI$IJI$I$RI$I$RI$8L$$I~ɂsJRI$"SIRI$")!I$I$ I)I$I$IJI$JNI&I:I)I$dI%)$H'H$I$4 )I$E2rJRI$(NI&NdI:I))I$E"xIJI$4Jx%)$L I.&%)$N4L$$Ib$IIGRRI$10tI'ÄhIRI$MB<)$NQ38!I$`uP.>3JRI$܈JMJI$$$TI'LI I$G(lMTI)3B}!$$M2~ɏI&%$\TI)NTIH6RI$S$@)I$gpcNRI$E$AJI$!O:'d' $NӪtJ[HJI$]F}$I>n1䓌B(RI$S8F˸I3 . I$paH<'.ꤓ8S@JL>nz,E$'LI4H:%I&$ΉAE"Ly@ I&>):&<'i'vKI$H!!0KX ԭRI$X"k ID?GlH;;wDI $) 8B3_R2fM5'M)Ӥ)I$R#D?dTI(? H)I$t%)$I"$)$RM$I7dI:J]JRI$HI0HhhTI%I&IKGPpI($SQRI%u*ARI$$I$I%)$I2I"$IIRI$dBI$&I%)$I<&I%)$NA2JRI$$IJI$$RRI$%))I$tR$I$I)I$I$$IL I)I$IJI$$I$$$I$I)I$yLI%)$N )I$d$I$ )I$d铤$I&NS$$I'L$$II%)$NA2JRI$2p%)$I$$I$$%)$NI$$I$$I$I%)$I$$I$'IJI$$RI$I$I$I%)$L'I"I$$I$'T(RI$>*RTJRI$s CEU)$K:bTI$5jRRI$źLyNQJI$(13N`H6JI$ْ9OoQI$" rIeI3SCMh)@&S0 UJI$$$u{&0T=I%S~)tHtRE$O~ȏ< ԭRt9ݓ"FΈ I$r%8 S9I$ vLI$v ']D"6) I$S:{'FhBI%wmaE$ wF.&rp  gȕg CEu"GC-B&%@ $I>$<.T҅$I;Erj-I$ș4m#jRI$Җ*Ƀ+RI%2{PdVIM"|&E$D 4Ĥ$HBIp  KU$SPE7jI$&I%wbV$I))$Hp)$O)NI$G)RIJI$TRI$G!L5Pp I$7&HMXI:dIJI$2dRI$&NI&I$RI$I2JRI$)% )I$I$JRI$H))I$ѿ"F߁;srOY$w ITe]$_־ 9h_ϛIC7S5:fITf]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$IHTJRI$I$I$I$$I$I)I$I$IJI$I:A%)$LI$$I$$I''IJI$$IJI$I$)I$t )I$yH&H$$IӨI'2I)I$tA"TI%)QKIH $I% %)$L蓌 $)$JTJ$$HR")$L&dJI$sŒ@R@n$ITBt$I-I!GRI$2E2¥$J 'II$' JRI$;rܤ$H '`$% )I$d RI)I#dRI$')($N&&JI#IRI$RE $JcE25C;[jI$DT֍RpRI$j 5jA;$줒I1)(xIIO3?줒I8 K[II825R2c6R:I6I3 ɔ$8KSjI$nA&a1ԧt|=JH&J}4 B'UDkIƀ)F&lruJtUZI$}v 8tïtA$cOײ4. H$C?Z Y♓uMII<8)P5$I'tNxIJI$NI%)I PRI$ħ)sqRI$ZIJ RI$M RI&*0xEJI$4HLo I.4$$I< $I &윝PRI$8\)ԺI(%DPZTI&I )$LA$I$QIRI$ $$I$S&)!I$IJxjJRI$O RI$'%)$LxHI$JRI$Вt𒔒I&NhIJI$!(I9%)$Q! RI$' BJRI$I4$$I$xIJI$&RВI&NI)I$:)ȅ;JI%($I)&IJI$'I$I$BJRI$IBxIJI$$JRI$:@% )I$RI$$IO $$I$I)I$I$$$I$2JRI$rI:I%)$I$IJI$LRI$'O )I$yJIJI$$$I$铤$I؟v4ORI$R*(I$9I8LSFRI$GDrTI$dSAJI$ ! (p $$Iޤ4Qq!)$RH I I$:yH%)$HxD'%I$b;IA4!I$rJw$RIHJ`I0H黢II* 7q V0!MTFI$A dj@\B'I!-BI$ʘQݵI$J$Ds$&:KI(VBZ()$Nh*ȂtBI$<#TM!I$Za6@ZBX]ыH#KZP\{sq t"{&2Hn  A]+EI$_)SJ)RI$ILiH:Sim)$L 5)$O $INJRI$)H$I RI$())$Nb)$JR$III h(ҊI$ IM)RI$)JI)&a)$Q I'(I%)$H6I*I$$! N˺)$CrLXI$AJI$IJI$I)I$d铤$IN%)$I$$IN%)$H$I)I$"G߁;srOY$w ITe]$_־ 9h_ϛIC7S5:fITf]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I8)& $$I$I)I$I$JRI$I$I$I$$IpI$BIRI$JR:$I$dTI:d)$O)I$HI$&/$I)NRI&HJyIJI$JrI'LSI$S$$I'LSTI&&%)$LQ$C*gIRI$JZ)JJRI$@蔦IJI$J<)U)$O%LL O RI$%4&T $Hn%A)4¢I$)ZI$A$$RhMܨ)$R !HpI&BnSLRJI$D)#JI$ƪD$I3R)!9)$J4I#H)I$D$I)$V)eBtSp%*I$5i.I]$L4{R`a J=~ĕ$IBx%#ĤLǂJRI$ݡ"=Й$$:qqK:2E%!$A CP> ߤ$I<Ɛ݈L4@)I$DiLbaM0~`I% IOw)jz$LȄN؏4PI'[L`p%] $Nc'D!I F$H!e;usVV_UNSDD({$O2ntRI$ SNA$I)LSPI"RRI"RND%)$L5N4 4))I$Se9@RI%6jItJP RI$RI.@蔤$IG $nID$<%I$w)T$MДHRRI$:JI$H%)$LBhR'$IJbSJt$Im"5NJi @RI$6S)J)RI$6p RI$Z<ΉQRI$%9)IJI$'ڔk)N)I$IJ;')wEJI$ R))I$b'DH% )I$NRI$JRRI$K@I$ ԥ1*RI$N&थ$JA)BTI(="$J;aEOtBI%Hp0`JJRI$`4NNIJI$FiO%)$M B}JHRI$&RJI%! #U I'H4蒔I(rDBI$НJ>TI$5SШ)$Ie'HH($L$Ӣwh* I$(I$gN$^P$JyC;)!BlN]bHlNQ|LX$Gޫ9<Y)$Q)$RAJI$E8%)$LS)9E$IpI%#)JRI$QRI$I%)$NJI$$JIJd(RI$t $ILNTI&R%)$Rn?3p $ID(Q&ɔI8H b7BI$D]!9*I$S w@!I$3RI$MDRI'!%$$JP@@$I:rI$fBSPI'xNM)RI$<RI$'8)%I$y26H*U<$H NݔD'`!I$#u˴I#_VI',$w"tD[)t$e~*ZtM$j8@* I$u&"p$I.TI$gdۥ8%I6R"Dƈ)$N Ϊm4C#bI&kgj0tJI%gQK<*S'H$+\6Aϒ➸T"Gm,RIPɃUUU)RI$RNSI1H)L4IJI$@I$t)JI)I$E)K)I$iJR$tEJI$ I$2JRI$OdRI$<)IJI$HI$cpRI$yL $$ISJII)I$Z$H!I$nɁ?d"$I'<'쒔I&ܔ)IJI$\TI'LI!I$I$IRI$I!I$IJI$$IRI$I%))I$I)I$t $$I$I)I$IIJI$I)I%)$I$IJI$RI$I$I$2yIJI$I$RI$I$I$I%)$L$JRI$ҊJ*dI*I$uPR*))I$tI$)$I-I%)$I$dI:dIJI$JI)I$tJJRI$D RRI$JbJRI$$I2II)I$A"I%)$I2tRI$d)I$I$JRI$LI&N$I'I$RI$$$II$)I$JR rDW)$IJpP*p )I$m9O !'Bu)$LR:')E*I$)K@$I8 "$JF }cѢMxܐ^k)2tm݌o:Vtɋ6uL%/Rxz`dtOvQ঍ҲI$#U:<e%"E-Lv< SaTI' ӱN[(IQI$Lc<:Ju2u@BQ\`q0T)$LJ\)8ν@RI$S@)ΨڔI$tMR&%5$M"!);I% ը(I$Ih&I$ RA I$)CID"uHW$I$IOPLD)$RL51RnEJI$ r(ԤI9N'"$I@BE]I'tDd)$MʔBH$I$t @MuHP(*I$!- a"tL4I% ƪm@Ce)$J`&@H@!pI$lD0 L 4NC' 9 nnĂA:vn;/jRtC Uek+Xr K(tJId)$Q0NdI0NRLI$( )I$pI%)$I).RI$ݓJ:$$II(JRI$J4RRRI$iN JRI$6H$$ILI':&OdI:RRI$)EJI$RN"$I)5BTJI$BSE*I$'BI$IJdI$D$IdI)N%))I$I$I$I$$I$tI2II^[?RXUwIoEJcU!' L#ݬ ;I$3.I/־ 9h_ϛIC7S5:fITf]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$HI$I$$I$I)I$I$JRI$A"JRI$PI)I$I$JRI$9\N't$IܣHRTtNRI$7!"$J%EHɨRI$:IVI$R2uNQ RI$Ҥ4)@I$d @$Ir@)I$~'()$ItI $I""$IwHPRI%j@^WTT&Ny%02 SL r$I X H?HI I$쥬&$P*I$:32RqRxI!I$ZΩD[I.RlxP12GI$`'tȄNI@jI(eIӢN&A:'y(oPTI&:$:&k~)շRH`m=I"OI' Bb n$ RI$ΪNFu Oi:) 5 & y~JjPQelԝ2t)F%I$BQp"$IDvLI$A$H)I$hNR wEJI$#T) $IdI%œ(9)$S$u $I$2 RI$h4NI.DݔDIE1R)()I$uP) $LI$$I$2I$I:I!I$dIJI$I:dI$I%)$HNIJI$ % RI$')RI$)$RRI$I%)$L2tI.RI$I$$)I$hI:dI$I%)$I$$$IIBIJI$ <-Vax jˋIqHQ"+49U ^kzun}J1 J)IR BMmqcy WNST_@,lO@IB뼸}(-m(/}!(O5Q)ųs؈c户GQ|RU2 6oB>iF @Y%I$@')L$I$T7)RI$*upn*RI$9Hh$i)JCiyd4ΜFyRq(E$M.4 ]2tɆAѨHۆB;$IO L;G*.qSiR;[R鈔)xS:]0(II$pr}ӯ "3(ꤒI7)ҎpԦo)ߧJI"gB']QlB)PN:bgDѦOD I$%0?r~$IjtԊ I$R$i)6t-AI&I1r}$OdO"a4J]BBI$R"A<#H+$ID%0Aݓ9 _RJRq{Nt@mTI'iBrvD;oo(t3I `G T$(Hn$ *[J?TI(آ8{‰E#dr4RCp) Aᶨ!P|qY>a}K.l8w +R™f>`U-t?'aK*.1K|Rڄ)^hgPcѸKJwLk ;QlQZ7YJL% ;KT}nZXQfV8uu2Ƃ®cZiq:E2BAkwQs=Vmo$}Fʒ#(9!Jqx%kQ:)$xnD#PT?Fu~dt'ܥn()uP#OdP$RMgNg3rI1iJ!1e"~ I(Iۄ!۔ѹRtI'U"MQRI$$ !Ʃ{'EJI$puM x:$I m$悂I%2`B )I$I(EJI$eM)$HtDIDTI IJI$A.PBI$S $IܣwLI'#D'qLE)$NTe(I7R%JO&uBI$AMr>*@%!I$DSJA*I$j:fRI%&AYg`߉IJI1 rm%N*USX{oF޴1Ӻ HA#+-$C~)u2?Al1EF~A `?J!G$6S |o}~AO_U﮳||OM 'F[DH!f-HO"9W%AdBΉ!IB/rAU&$wW_U1pPF/wV k !Ktv F8L2Bp,ZC5Ȓ9ӡ}'@S@*DDlq LL"$#IH< :yEtI' */Bw@z)$&ݮ!맚vt) J  4rHH TI9'5) TywDԝ0N %I$&z)I$SpSNJRI$') $I%"QRI$] RI$H$IJI$A)DŽI;f!<$8M%)$NI?dݒ#$KQ8A I$v3g$$J.PSrHRI$dI8$$$IHIJI$LI)I$yLI)I$I% $$I$NI%)$)RI$D$RI$% 'IJI$' )I$dRI$ $I''IJI$BI$RRI$I$I)I$IJI$*lq #*\Բ鑬$Qqc0} f朗iZɨM.Ӣ8ŹZ|'Dx{lPpgF~Z5AcHܠ7ƓMyNp -q}Qu8[s21hz{w;Ke$Wt&,\VeGe;Yq/ UW x<4GIQ) Pg5~<;wT 0V.[r)$F=Zw+?+'=ƇwI@1))kvr/߱D9hZHYNVI0fYT*_;^1DsVo%pSI[hMiU.fRQPNd?ȅ5e8&c۞5*$;8IES%s}V[l7v}=%d8cI7'KOߪMsQ*OR+ä:Zxmbt>k3!Z>hBIPdԎt(nkИj+۸(SG_+a'iQзkcFx'v ĭO0 !? 7*'} Wh6GGV7?ƨ4L{OBA<(Oʭ*`cDxt^s\\L66!2M,%G+kԹ0&PI2cX\UafӰ&49ugJ{0,lI :"|P^ۚE䉄>=9ߺ8N]n LC~osu?!{wٹI fljf'܀EM.cksLFbL) 9ἘO*Mxofj)SvD]PvGbHޓ#\^JI"g1*@¤Z W@B Xv`pC~np:=7nDB#u9Us6MH;M/m;xMhsCOG2m{+=Vo+F&;Mʞk&Kw(=:nYL¹vBeNqI[JBU,6Kxꍪz0$ۛG8kiG UlđiekсRxN갰6ò0an&k`dщnAOZ2xoPm@Vʥ6^gWw<0K!OdѫģhWbUmuߚ֏k6F`oIZ59cy)B~[ [2ƠW;L'cki&$C<1и7A8F!5DxjHN !켓 2:V^^a:8cRPٓ6,aK%%Bq$IXηM?vCjoO̭*ˬ n檶zw}(.u@+vOqMk[U[Pn"f*4u;FvN)ulYomUA;>YA}ǶMͭ~+CAޠ~:,Νn! oYuGs ൱zxD%hP_sٴX% aVc{~m]bYЁћc}\S YLuH%sCP؎5VQm`lư8w[XoP! 24/%>pmTF.Ic;Ƴ#X/{lLuZ&ի]ֱ2+kG?k|VD,{)l.;8Jʽ\gdO kS\h$&s|Cjހ2%IM)>V0STh`WOj vDfkR?yrGݩ#$$ N6Kk;6\X=k{7S„bcׇAwiCv[ Ie RpVL1HTW@7(6`$&Iy>R !-ޚ`ҒI$5dScRI$>)a(e)$K(tR'Dz!I$ ME MJI%I?dI$$JI$8jy)$Sl I7dݓIRI$% $I'rnAJI$jI5$I1 D$T))IZ]Q$i7(杔G-Oy9.N]5/"s{vrjE4KnN V6?z 3 k "󿪫Y~jc $?y%y0wpxDp)XwݣG ɩۣF8$$->c#ݮ2MJ\')<(4Y4~'dߕܟg &RR9H"㔧w:\cxwf󢍙Am>~d}@I3j@xO܊-MY_#F Ck + $hL<:j7Jnr;xK5Hī/mLa+#eP]ĈoɐP-eGq<y7?OYvnix 830BbQ'Wn~S$D~i(5~ P ETvĕ'7kE`"R'Q` )$N BoJ $Jq5Q:pNpY8I ?FVL:Y2?%]5'L$SJ`tS^?4o|kIGpK{|B)Fgr&eOxLOdJ$xPVLFR_Cwݭ>)*$x&ey*JtW(9}`S&8zjI aLkP*&DωئM!7!;G*#.)WDbS^$Rt~_s l(! ILL H({$$JM$0)$I(JuHjI&#O)TI%IS˜熟??$;! 2=8W^Hx#OG%Qdmb\`(x*)+t{G[lh<JTjeXC~`hX[GG`uUq+ƲSCA$IZIgِ6=A<.n>i1+fߎtZ[J;Ą'4~o(p:Y\̘ݰ•]2[9ȝVݝACi񳺩f;J U| +<̷< OF}6xh硲דTd? x8q[^17mb]t̸%d6ΧBv-]g f8 k#Oc9w6EGET'h2Ą•4YfZ ؎[>#XkcciM]HTd$<šmGpѫޥ,kX(¼׎ZZ%^m6uq!IZ3n^0% 'iࢱq< 7ӆzur] Kh{7֢;'Ѵ@<<~wgn >#Գp?Cꑹ-ow;qSX={ E7?VΉSK6qT,սSA#w.[ᗸYwp?5uGڈ7*n7 />W\-@( A8t ,=i@T Ըۋ:~kp2CoQqO+nخ~ރ_ U_ke\ߤeW ׏svҴYӧϲDzC{4|y,&W[wӟwQ. сܕxDv49;& hxXy 60y=LK|pIs^NVC`}a :[_ $“"TNm,h08U̩k9YI(*I eu%M }{8AW՝W1 , STd+5?+),nfBJ"Ja,|ҷO#wJ·{|:1꾟A&х :k#Nm)PvF-pCĠ|?[~j24 ϴ1v;ʊ){u"dVfAǹ:zۛÖI;t- ߳*S)#"mG> WT-lwV td 4:8vVr2F]hx㺷zٝZܗW;F6{֖;ҳVYzG%w '[Ɛܖ}Q/]Qx~ > ;!AI]A[K!>V?4ʅG{w Wx8MUQ>}qrKuM(QݓLCw6)FR}ouP(ckӜ|*5 2}c|Od"7\?s V9q_3E7B8YR~샷W<:ucTʰ6\e>U1IȺV |vnwLi'J%ޭVf>NJ:X߳cѡ!%xzb<)_py=}K5qRKy(0U+ hO]))$kN9O Zڛ}Li-(]Q'۫kz&E_ceğ]foweAIi hhh$aVɃemVH|k2;%p6 tJ9ꊏ@LiV9NJ\x ORJg$h/׼IZm3kU0k w($AMV cv\caFycA'Wkd ZF5{@JJ:hݣ7X7Zl%ot蕘؝Dk*xtn>*9x!%m<8pL}ŗc[o6W *ê$;TuZ՞\|UX6aK#m+AUf&V*kf[%7-ZXعVai8Vpodk:5v y43[sϪ`HL,6ǯ,#ECM?V32a*)[4$$ݭ;),>Py6?L\u^7Op"vUjV3 7a]:)˜`ʰ{pܟ8O LpQxB$DF#UJlw*RI$#TGJ54$Q%g GJRI$(H$I% ItI%$$I'I$H&)GTI)$H$ILS%)$N4R|(9*I$S"SI!*m*3MQ;(줒I;@R<( 1I$AH{JDI$m)DwE)$M3\R!I$vO`5`6* I$bTƊBI%c<1CHX)jeB*5T$8 +V$I&NBI$D$JRI$ O0))I$iN BJRI$E(HjI$:dI)L%JRI$'M y$$IBE" PI&NRI%%)$NBrRIJI$p&R$$I'LI$%<$$Iw&I8)$BxIJI$  cI*I$") $I$$I$IJI$I" )I$I$JRI$I$IJI$I#JRI$I IJI$$$I][?RXUwIoEJcUa' L#ݬ ;I$3.I/־ 9h_ϛIC7S5:fITf]$I)I$I$JRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I:dI$)I$I$JRI$tRI%w ګGh(Ӭ8p Xu82$ M-Y:I$^*"$IGrIUjI$HE1AVIKzm)I$#E$$ILR$I' $I'LI$t)I$II8&JRI$h&-!%)$LTQ0RRI$甓wNQJI$#\%%)$H)ʂJRI$L `I<ꘞS(RI$u .S<(;0I$:KdI9I$J*I$T7I;S $Q옩hErI$$HRI$L '@)I$A t)$$I\Z{:?91/:> Qy RPZUTs1cwkFcv@Az3'05<2yA8{FX;?G܃@Ã%y/|#eN O\ݎ sY5gzW]iRqi$Cx#Tv悁m)/;o`Ʒs;$[omcĞ%2[=KNxv8T@$Gd;);$b9 c>En]O8" Ll)4 e6{=&w~`ooZwV ~UP67"#ep}:;}LUߜ+5Pʆʀdmo,HHo:Ԫ h"cNcv㕭™e`?8u7p2HgTKiF .0N {Xv>.<e8`>#>Dp>=<8s\9irmx`|Yx GrpǮ4#Um|S}=4wܭcv4N,t^&֫/uJ9+*&}łHq'gx Ftܡa\xhNP2z0Vca/<g7jF(Zhu]]otH %ġYiNen9'UbklrWfqXnsEn-$?+Fq]Kav Kڒ. 8J xZU}Qm;(?hX5 P̪0&^iޖP yߘAIUِy>5BcP#uFGq!ݼ`Vz[Hi2plf_WvNs n({[I%t.?{$_ctG[>FMxE ݕpOkq[I68|Kf8Ojʪgw'7w?nImkGF> I!daT,8iPBɏZ1_wd{YȬp0WϻwchgUc{iҝ]9Vũ;eWv;~9ߋzL{ْ=8rIIvB;n!p6fG#W5ui ^`k^MDUͿldBn3mnǀZ{}wRXv;Jl ;?}9dB܂ӸhUlfP%&;UTu۲>Y~Q i-<7-WCw`vJḟKknIH!N;['X4o= Tt Xx?/†jd;kx iqy'1%Wf- V!kmա҂vRӵS;(E~#*e@APAEĚO#VK{woVj{nn̂Os'67"cء2{lwlx}fBPTOKp\m~kEF׷4II<5tР3&Fuovmnx!Jr2=ڸ|^~Gф=ڹRS) uV5bhY3 zuֲ9YkD+{yoo"3{qR3s\zHf/mPˇsC=u ~dF7J$RۿECfE01-ٓ6OU;٭GpBu  JojW]\G-C-<*,;u\[Iip4Uui Pv?,;pvrgnf'FlnЇD\U%%MBT…`*Z_!4Uձ)ēܫ}2\l$ʨg2a$eX(DŽ5T#l[iV\U,jq~Yşܤ4dJ@'ݗkJw^;˵f~+A KG +B)&@ҷ ?1D5,=dJf[}+txएQ' SD+}"8ѪJUvh~(5XawSͧiW- v)Z lBQ8v P>=wxhS jhZn}g%j߼Jjs3:v.y,+G ]\wJ(k4>'ݦeKªS<]~F+83 :*R%EcTϾm;|Pʧ]fk^q<+c:K~I'M6:) um6Wot;c:MN  ukB֩542갛,qǂIIK%g;;^ b_B-ἃ yߢRGXHS[5`C{ז⠑ [> =EŶp)+R`5)]vdxn5>䫿a)+)4@3N06+j噾xYӭG$t`4D||n/ȟ,7Yu( ?D$oFԺ@$L-.Ň׶6/QlFP ]TtuAq`J>9 N;]J OLn,wѧQG#bL5O+owMs< =tqK{Ӻèۂ~Ϙ7|s4pP42Vv$vnϊ'Q鞟VuӲ7LfMg#*U~!y,ʘO1x$~kpPȬG#8*LS?e ݏ^@eȯٯέFbq؏ųV⼖;7B-N`W-5^; ]T=ݩ7t4*ܖX1*}s|MO;Ț.,ZiʕX-};L,|S٠J䒿U:|7j/S鵷o:4*X;U^(hB@˽PyMfKWې啍ZZ9N~F񤄑z/Լy&3K~nS9cx|qugDe:;}Od<$Vc Svc6Ys_p`zec?Y|^{z{q+,JE{.${ho}OY[|@dsw\Z+mzV>C*a̿菢,wl@`ftm[aFݣqgxjE=:VߦxUWLֿY=H?sV̴`g[k_ף%ף%ZݭVrS?pzqt0rTM"˴oa\QɟI>%jim-,ǀZ6׫|Z0{WDnM4 uIR\M=N}ǹ#2Yc*$QYU^ k{4(e|m> .`!l[g׈QL1%ԝ]p2qc@ЃmU ;Uk4Tzu"뢥E4W5Ejyof=A@!+7M lVnU{,mL裟^:JJdmO>ECilKRƬW[Z;ҨzYǹzFZO¨afU}'QYH+A `$}*aq[8 BpF5%?Su[}ӱȷFV4y_?'D :L;Rc adj&`ԪؽRkk~rݸA4-v%uѓ2y5pIF;xR )EChDzPTcV"\usD+}L' c u=t<`CpT{$$)κ')$H7yHL$6=TI"$H $I<#I$I"$I—*L$IrI1H I*I$ <&$I~n)$Hꝥ1NH)I$wʈDI$xI(RI$)1AM;TvRI$ƪ2`I$LeGAʓ{N딒I&D&J})I$r$J_wA I$425Kt'DFRI$!F$u ptCBI$|.HQxDk*&PX)6C1:B`55? WEI$,®pyF[*I$$JP RI$)$IJI$I$IJI$(I$I2@$$IL0JRI$dIH&)E%)$L9N%))I$Ir I1J!)IJI$0*I%)$J%4x$$I8$)$H)ܛIRI$N fRI$NBHhI'H'IJI$&w*J.$)$H$qJRI$M)RI$I(IJI$I$JRI$I'<$$IL%)$HI)I$"G߁;srOGY$w ITf]$_־ 9h_ϛIC7S5:fITf]$I$IJI$NS$I$II$NI&I$RI$I$I$I%)$I$IJI$I$RI$I$I"I$$I$I)I$u:!x,rtERI2!<8hRt QrwI&%DꜨRI$diBI9Q)()I$d$$II$ҕ$I8) 9)I$tI1JI$I:I)I$ItJRI$8I$I" IDIEKD%JRI$eDRRI$)$M vJtI*I$E tM>$$JD)(aB*RI$:TN$"$J D*!0I$d󢌤$II.RIEI$ySw*'򒔒I)虩$)$L8M*@Q\I"H(RI$ҥ*'$I$I)I$EY}ս<@#;oYhx7R7~*ho} Ѵ)}ö(ӑx"ARN '!ZjM3`0(A[W'%1"!eHF>RGwJC[ =BC(9_S;=TZllS%Pġa$ODv4^>⁏]}fu2ҭUsn{( a)KȤSSxp(vFCeά$ 'u.srTq'eZǰR_IIK$Jiu}&4gcI0!pǀ*&_v4Ԕ8L }๯#%^8#|fK\ׁIݲrJS &s>!/$!zKmײ9 H(&OILR AA,~In(ֲ"ܝ-V}_v )h8ʗP洇30U`۰1Y⵶W$A>hѥpщ#͎|KMʷeciwլrQP_AAӻ{$D{ + +hruWPuNyDVFͻxi5ĘL[[(;80s(aJEVahݢwTz^k1sX9$v؋~sh;`熎OETy6Aoy;WTMl~dƋwg*Bu%xӳW8^5U_6b^vBa_cp]{;Mݧ) dHRKcQH:5BLpx#U{\wL5?-MXԳ1ɨZӾG&ZTk#j.?ĩ>nP{?NͪjwH]*NC1]cDU~1X>[%u[q5)_Cc"41kSʬ Ldb?wV1KY8ɂ>j 2ߌEy|,D~JW+nIAp&_G<)u_6%ΣIFI&ǀATl{`v +?vg?մ<7) Z` {?e;k<{ꦲQ0V 'la$]m4\ʽm̩0vs;cYRAem8z7E4UqLAʩ]N` HA`~|베chnn77-_RI($_ :#]Nqvs?TJmm `Oj b`ߘMsQB{$)%-Y\nZUԅZbW.?;}hVs>c7Xpԝ~ NJW[AQC_!_=6S]FE]Nh{A2hD4eV]a,{,ih.Z~kC^8q*umߐ`vhNFkc(das p<-D}P%1~Y=4(4Q+iQnKvB5rҡcnp}-t꣜k-RՖiv_[xiiu?wY0%كۼΠ2d)' YSqp{,]yV:&_Q.@z9s[X+'Sۚ U*9][!֝`DPz9O:ѯ]K}^;؉)e}d[O3`m97xCгz9)GDY um.a&s}GFw6'M%_MtyQߢj|2s62C{RP۲.rTeU/j}snqqjQòzmx c1i(%:+>GlmO%+Lu 6?kw%_85C ^5w)3CeF( 9';hݱ+r[h슛Cu,vEEd>2p>+I1BvK;w*ѧJY_W`ٖ7JA"cԦyw0IA\VtUzkre[svJJy&9C^`pi~`hxg]j܌| Whjr΅0΁K?֦X赣4݊w7klvx"=l4<,iNs~( 'Ae wmFGM(۱Ô]?cw7/)p%3rH~T' jH\8E4i uv[~S`̦7Jzf1=+8[`;IL\`Bb7 ҅( O%][1/ƣcOnwfS+mh.Y.!Wӣ{yk f㱺#qY\QG}'wBioN;sva.i,))cP{)GeݎHA5eXHoOB×}}E?Mۏ(V F<sH5IF~I5x6?W{G Җn:RGŵ^-/$ v]v$m{'@Ѥ꩜gv*֚]8򬞙s"t5c[&8L5?Uѱ(uXK,ʮn#d$w@N"ݝV5Sun 73 LѴ2IDuL,'U'%V- IBnI{,$+f6HjmTɃzCdWwVoV  ٧`$Ĉ \[nwVUlY`BY%/P JTǒTѤ!אveѱ9$6(6OqC%Lc{UgX6Sְl#s椏|R.SBmcs qQK ~lc8w/h,?'5ǀW"VT2@U-@o,uKbūt1Iqyq%4Y8tJg,2Usm}OoL6dbTxoO -;hStZ:C[dkDS8y }OEnhp C\Ú{,eC6Vf0I;15 qݽ0dhQOiE4Qch6VwQ݄sge#C*}h-̓^EP`/;]9Ǎ<F{ [~VYKC+fI4aU*uN wrZWK5)+^es x?kims[D{.y=A{Uc^Gܒ0f365h })=16pus;#u i׸<IO6T\mJI,X?#z&fC m~EzYXXG*ɳ0찖yZk[}wLMN}fe=y⶷P,^C `'{.(3~rW89ڒөF{ؕ$OCV;=c-? ǻGI-jݻ,EIgrq5r ޠqE4̕vkgЀlcRZ}r_cw_$Ugw f}_DA_7k/|4v"WflWnSvвGSw)59ܒ%_ڏs)ўĝ2JF;4H%\;co3s&s|+IMvѦ%֬U}![[e,\Xmo#QԎ h{Aq#'ɻY->[,ukX6F?ZQk`Bljua^4ZJH'juSATvMrVcsNj8cyWt J$MqB`ױHuqV%YOui/4M_)]ӣTrrߐux)c] vcicx /rvTʯ.isXip{UUb O8f EOr(BL4Q{Ť8rxXnQ]CrJ_ŽAM O7{pಬح\waICb"|?h,Ҭ uA`i%Ug(s[g]Uѝͻࣇ~ va ]*jnW-TަAG_gkRꮋ;k Qfǚiv&Ǥckza9hʧ{Wd;U.}H) x 8uq%:rQz[U>׉e%y[㲻̆JB;GTis!܂OS=sˏ Uh*~ae8*F5x;䘺  pOI5t~ +գ,pk)m9 ㇵ,:<4$RO@k>$ 4Ϻ쿆4BsΪt\ǿ6 Gdtb_9x!#K[qkGZXVaDeHCw Xkb'Y5~\Q x`Ku66uhe:t<.Qk5yJm#̢+l{:xB.b9Q~uvIZ3 LuH4%~mGTYwi+[ UXvn;[? p$Pl.aIw.WopʶNmyv[n]o_P pTKU&OX7xkyiJMO v9{[\ID8N}(˝_Zʍo-=/Ox80u},EBI軴?*6 iCТ GyY\n%Yu7s$$BZZ5T}5Tmc1%'* +P7Jh$S~h}F~`h@$VLaS96]O oIK۠RsF*lh` 9W7iԞuۋ[\#V kxV ms]= cc%)<vPKl-Ma*Կ)ޞ5xce[f825rC z2pЦg@Bݕ[^Pםq ?ZO& 9 j]3GIW[ikowf?,1 - 'S:үB9*C} T{r.; L!b6YN@ѴnдkO-Sq2ZI%?)vjͱJ* ,hh4!&p঴pg̢ Q4+ uoѰ:}5@VX5s|'o1RO_$ԏTrvϠiZ5tkXK *wzG})Dv;9(-ޑ:s(q~Ѿ(Ub?1i;kGCmc&[uj3?@))wV6V% !L8xf=XDl|\kAuQIm}S,#5=B=Qcfv9E~ P_-;N4vV+-\ P;ç0PZIU*!ӠsX5cI&yOWEȨZHDv&C@X/{ofdlsY(qP=_һ-n-Yt6Oo$t0qiXn&8HYecID֮WaiY y(81_v۔=w3Z6x{0h1uRQ:*r8P}DeKn5vph$cXm6b`i,:^2+ljOd2,'P-KKDʚ瓴Sl:DUWhvCǹΑNUESa&ӥMW21thd`}:K}7,|L+n6S+Ϲr4U 7:?1gу\m{;ƚd{٩) }70rl,WzԨiԝ}VNo ΨG@XP6mh$v_4}!|Fok2;)QK1QZ#sNDD.$pttNu'*I$'sKRcRI$$eO%9=JI&p())I$hO JBI$R!EI$$KiNSI&%$I:IBI)I$HN$)$HN:$$Ie4BQ)$H BI$ ᲔI)('(RI$4N5JJऒI09HjJQI1?4HK 6RI$Bh h} I$9LD( IYeC C԰*"lN X)J)2A QƽZ#SKJ9DTd UHH$JPI$LI'H$JRI$&O)rI&NyIJI$BILI$t)I$II.RH$RRI$d%)$MӪ))I$btI%)$LE:$IdI*I$~ɒ%%)$LI$$I) S$$Jz㢗mSBJRI$%1HI$I$$I$2IRI$dRBI$'I%)$I$IJI$L a%)$JI2JRI$I$I+K~*W8ʮ-ȩ_㿬*?$?d:A'pPI$FeI%־ 9h_ϛIC7S5:fITf]$I$IJI$I$RI$I$I"I$$I$E%)$I$IJI$I$RI$JRIJI$I$RI$I$I$I%)$NdRI$|fɕd V *(*I$%DFS I$RI%)$JSDPI2I $IJIJI$$IRI$$M*RI$"IJI$ 0NiRI$tҒ RI$I)I$'D'%)$J)pI'je!($I΅ITdII$B)RI$$IRI$pHRI$ QQRI$*;T5GTz)I$R!@I$ FAHBI$I RI$ TSSIH jRTI%7dM9JI$H!9KI&[4{D%6R7{>[n3 uB}uGk>I[-Q}f5S!0tQ/e-A2\w4TYG}`$,Ɖ4 37;+i_"2wۣ{7&b4I[vw*֭[ݿZm[q+.m{v;J(,RZ!ߎbY56d;ӸmwcY-ݧ!%/?):{eMawɾ tⵙvUsT!yQ.(U,c==?eƺ5=٪uPDO$򒙦44%X|\3)܏s;<F]=S8 jBO aFuG0{v5}[݇Eعuar!LtSYNJ+~Um[ZyRf+F^xhK'"L\>UUM}c),IZ, 5m>%;,5 y.!ޘуxop/5rv!ph.q9%P6ew?'&vQ0lT[qot>x5j_پ UMƌqߜ1ج%ѽM 4Hmmţs(?-,F<<7P5YjdtO y忘~z`XI%T-ǸGu:BUcQ#{ӸzO-lk)1IA5םh˿ڛ? qe'ӤKoBI/4aji}$>ѹ;qz\yqGeRiA5mF"+C|M7{voԔͮwvSu:Yqu:56M4vcO[9nӎ+>}=k\ N JWa?8KwB <{Ŀu_56 s ճoG|Ry#[,2pI?zRvECo à˜hgT͠sH2xP,KZT6f\yqV;Zݬ}Ŏ57? 5)Pƥj% (6Q?E{+*mBH\%I)>!Î<ŎVwM&Zewceyޠ$wI*G CC.c{ OV oU l׏*OtjnVӦw{:.y5bHO?E' v1qǒkG*YV8gs g&7Zbxh䢴󧒨eĹ_b?*}cM)ӥ}VkwyqۀoÿH;u97T/^5Ў*ջӻoF-mxRS&T su0S{7c@UoٍvqW䔚a1*-v4*/ Z ?+x7fWIW@%ގ0gsI8ԡY :OoUL^ϥBcӹ*Ԃr=JW/2|z>MLI+"LeIQpQւT-Aw:G,9KKX$SY 90ʥeTceK:rkci*mh-,|}"3./?GRO<lҳcX+4;vcYu+~^tcD~CEo;4ahQb8룆uus`jkFFBnh%kQwX|Dz%wl_r~1:Tw85kP-O 9r Qy +''1]$Vʁ鷓ddz0SkCD+xFʝ;tF~aT O>]ͶZ6Ջ? rVhKĴ[k^ *dd$;DgeڙrGM +F|(ƷZhcKǻ,%ù%'!`;RO@Jp5 ˆz='5B ;!r]rHSwOco FE.p;k,=5y&8-*Vh*=GWKuUz{(o۴!NC2Ɛx hM=mN(U0;1ضA*FnՀpW3)oSU7W`m:TA *L>= 8cխĉQV{ *ms]R'ď<ˏ#_\> +էࡎ!L?@+?Xˊ_îUd;賏 "k[᪰LjP)s4Md4V]h؍HX iq nK,]@^1+^F>\ j05"aGŢGo#U `3ݘF|fkѝJ& ,{_DrU55 &$$^;@ JMhU:,ṁmMPf <*uavߕ,;\kΚ* ض{)tX]W^Wc[ao_XҳKZ?䥲>m-%npTb;{ua,{OvgVk~T1ߎ[!i34?fͬ4ԿpSc7oyT:u‹OB1W*Xy S/&>9I])h~DB K{B@w__5fY^g㢏Rx)+`wCn<;v`%f-m/wr埋WkYRQڼD m%i!BT8hAxg*᧵u4}#!c nTV(hPͪ=8;T7跟쇊٩)(9 4lJ7f !ߘAZ]bheYԽGtTVe2ZE&,60@VX4=ȥ֚-+KӒ;hT"ۖ 0mu * 2bq|\~W*71VַŅCvXLY:9H'$HipK,GEf@GeUϵf~wp0@I]mcav2O`fa˃?4jog5,,GٴxˊIWVW*f-fAVm7qS=ٯrVRMgٱ g3r9+#2^Xv7*߰AǠrx SS> \`!hJ p!Vmxuee .t%UT-٬rz7_]MCT20Vƻ Oc\ێr~n- (~kƿ~0`£"])8Ee=tKn?qD1> O_˻@a ʏC!F(* lXj` P+\xK-hcyyaو\l~ku(7Z컋sݢٹ¦<&ߏ Z\yֆ6UhUo=k8E跕TP67WVՏU[;+}Ṉ*1?w4I;$nvGOHUk[bx vۘ胺,7n%X~U;ʶ-#_#$^yV~ӴC2o/ЗD $,̩ljgᢱИ豿ȳԱ%]ymCCakhC̗Syqywukq*8̰{Bg2u}צ((wfѴ;h{W.DK ⣋Qcw;;R痻z.hO^/>A=K8}: .J` @gEz6vWݭn&FʖFcasϠѪ'\gNgN PxV2/m"]*uc13Eb۹'~w_Ss]n$S+i-*ƻPHVۻfݛD*ؕ<44P2 \V[\_3}: :+Ifj2=SǰZhFM)ɒEtIDGDNI$S e0a2;)$HHRR$IRI$ȔԔID$"$IBrrI%)$$I=jmRRI$2I!I$b!8"RJI$8M$)$N *!$NI $IԃJ0N)I$NuL3)I$cSגZTI()dө?#D$QׄܔJ RI$h DlTI!ŒNp*I$Pr~f l)AN#^[Е#hiLZWI$h%UV/ x*҉KIBhHҚ$IJSI')&$I$$JRI$jxHҒI$RI$I:d:JRI$-BiIJI$(JRI$AFRI$))%)$J4HIJI$%2xHI2JDI"D))I$d)$$I)5EM%I$!1'RRI%d焏dI2I$I'LRI$\%JRI$IJRI$&I$I$)I$d$I%$Ӥ$JG߁;K~*W8ʭ?baΟGgpI$I%QtI־ 9h_ϛIC7S5:fITf]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$S"T5@$H&%1)XZI9)1)FФI9)&ZI$E2 RI$IIJI$)tJI$ɓI*I$I$*RI$$LRI$AEJTe!I$I$ RI$4$JRI$p'I$}BnSKI2P&I9E/2TI')&!:JRI$4L8O$$LdÄBI$(g$QRI$A#ʊwE)$P*HPvRI$4'LI'NJpI)rwrdjI'(JI!D%&#DTI$D$P$IU2yS!%)$H$F$$IbShI:[COvO0X%it[j?"N!^v P-! ~6;ۮx  .2؎ui-69JNdZ+aH h  7hh┖[#QE um*ˀ"|RR䄹3E {Dzo3_Uf[h$]F?B;O(jPc/YG;YkI,PyDK8!g;@`ni洱CC49a7{ѹ=cuJhS{o3;{]}Ws@h+dmHhOA͍FW@Ze*VT^%a/RNȝF!ӦKGÔ\ `W2 }^.?G%$}a";,9vcK~(_Jd婈 AīU"?5U vhhk#h=ԮkF02m6͖oi?ĕխck OOHt!umxn4 ^>AϭPhUz[)뵯 3;,?5.OH`'r*E 6K$f O`h姿%7հnCNu3Nϩo󛿐ѤoZ.M\XDߺ[:~j78n;(R3P׻*ݔqh'CkR[KM0e~ ?;oDWwۼ. cku*ǠVw|~l6`!;fcS=4#?Z۾!'XVMګF0|xS>A,;]DkoEQH(t_ޕeZ> ކ!#s|TL QCEqe9NsjY??n;D7R|ZyjSRs3sGGQXvF/'m > s[sQAb1kiИFv w%0:Sd[{[vZ?cjV$pP,u$َ$wgZJB'T'YoG}鋉P %2,r!6JP9#CIX"c]Tݛ^l;<$&C^0Н΃@wߧ_"D[sh0?/Vv&XIK=`$KOj6;D2) rQ~k*nd .;w!IyN)2+/:"ӊm> x$Rb9Pߊeʽxa-<^zc\*w W%hfƜaYuGIkG-m[2s,]OwllFcI^Ik6xu,oP4JRtLZmyySvK}Mmoӷ&6jR΄€S.ckvSYa۝6.'MJ&Ps˜g87R^vS q\*룧7sT:0kP]'?ߡHY)WP`W,f^ cOϯ.ڌk6[KrX BJ9&s^82@*-0vHGxXYY~+We qq-xIG*ܣ ;#Jv~3EPֲUÅiBoi PVz/u$n[ nxvJ7JaO׳).#o;6(- ݺ,>ucn,Űя k|n?ZjnzSz-!ÑBvV43-cHcc2u<ՑqoLc)SUXoyw*oG>_h_ES-F>ߠ-oeQfllWeA_.!2QC@g. J(`Dg㾛g^1<~Nc},gDswú(oh-Q5Av3;?%*;^6+ϴbp1-{J?s%B>Xdmoŗ:;9Y 8xmWO;>D5dSk:Op?z˩RS~I['6elv)7 w-<Zܺ=} WpnowcӲLJejw#X?4 k$ D T ykW:6n)[/[ŀ9M-Ig bYBXYޛXrB}f,3l~ 'П-YΉWIo7x̎VFEM3]ZJj<"#d:U0F5ָ4j-WGs㳦Trr?#@rfrx +o4Sq9o{r3菤U0V6r2eIލe7.IVlzXxJhhkX'V벽\8srE$l-50'Pz[N6[׼:ZNZ)7$o?{z\ ]1]mJ,dؿڒeTr o?TX)0e;G-vEAs 87dۃFwIK{rݭG@}.< W&h EuLgܬtʾ͏NP}55􏂆7M h;[wrJٱfJl7nw3'=6ø*Fz8wrߓwR ? otաBn;;T3]ܔ /-phV7n%r|JM-kyJMG@~^㶡 =MmvYHx[긵u}ѺK1&q9kGQ Is+^cۇKNigG?I^8[˹6͠J)c쯣UJ .%r>.Fwzzk},QܒXFKkneA!S;ѽN&?Kh$[,nivߐ1Vf[;lM iϊ^v73. +h=;꡾#~h^]c +M`x~u|gha\ީi?%SyHWfi5y+=k\U<niǷD$pP>PxK#a:h!`1H>i NYU:g{#+\Uk\[-/|SZ]WZ{KP%^xEpqK(9̥hK©Yưw*U~!OWp9;Eo5`Jj =&9+٘FqUv ~qDδ^X= J7QGϛo0ɩ`*m9zmDx2SF-Bm4rS``?)ێJz*4II>%|J 7#e3=YYMoWu {1|n{7X|l;2w%]#e~O%$n;գGwd2˾AVۘw?_aa]F@UgZtP˳!2TòX<{e>󲁧w"׌yX ;{dT[Y;; t(AB3>Ҫ-ܩ O 7SbR'DIF!9 OdA)$Ne6IǸOr$I@KrmNȐTIFB3@))I$I& D$I’ RJI$`BE)I$DNdI$dIIJA2HRI$NDIIDhD( RRI$q\%JRI$ eDM *I$ R3ALꠤIDD=BrTI&rPJrdJEJI$ I" DBbd $IhtRB#b$I$N & I$SdrX9M|SI'RG%5L@q$a*LVhryVo&yGR$b H)I$II&I$%)$N:I)I$P:I)I$dI%)$I$4JRI$HI(JHI7:PIJI$'ۢd%)$H sJRI$! I:`(IJI$LH$$IO2HRI$ *M %I$(EE%pTI!) $I$I$%)$NL%)$KE)IRI$I HRI$dRI$I%)$I:d)I$I$%)$W?Tq?][?RXUnXCtr?k;N I*ˤK־ 9h_ϛIC7S5:f)*ˤI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$(LRI$IJI$I$RI$I$I$FhOTI)JiM)iI$ dU)$O)iJRBI$2dJI$$JRI$IJbI$:dI$I$I&N5JI$2vI'I$A*I$H% %$It:HRI$A$थ$I% dI9 g)$$I9E*I$Hp.JRI$yGAJI$DAHI LeDEJI$ J)RI$:dI:JRI$ T]ӻI N$I!MR19JI$.$J$jBЩI&jPDJRI$ $)I"%Mxu(Bb R۸neds<j-;߫id[vx#pHԞbuFR Nj-kW~HV/ RJJuI@;P}-І#>zwmm $!?:RjmE^Ic~;vk+nvhi)yRtM)}܇f82ñkN*ln ;*~ wdvU0R%vc1.hN,?H/WwkKΉw63QSd5v#rGG%" sA1t< 8x&l A#?dl5;+iieqwN#apV͢s>|P Mm=n{Q+R#(̼kq);#٬Jz~ѠCc8btY?үWJ+cpoo_2=RF|r!PE-q}x,j&N<n+Uz]?͠N [˃m:l?GmM9i(QɡTo'x>G,>#ըo$$Ggp>ak˳5ͥa-k7W膍 +}4-v}(;S@Hગ'w.31NǗi>NS1ړZ9qTn1)#H$33Q+d~CUec͆]ہ 7EcHiP~6~)U.}~k5'gd+Je|CTʾnH A Ov[YO16XZx;C-IJmlV 6VYi਩WcaA*Yn 5pDH2-lzŨ1m~h7f=՝USO 1K%÷;NqdzRyww Zm]w(V?Qkzwc;KWM#-Gx i -3 jk?&G[*64OzET.mg̨~-EsG&_wP7WW1e#' *F9HcƮ렭.bdR$nLU׻jnwC{̟U/Nv{7-9qc.;- o_бioJ-B+hH"lflô]FjI |o?tp'9_;b6ghe>?3Kv6.a$ӑ .đR3;⓶-|T,}~ 4@A3i=?;1lVhf;aO%${:ꑽ' %ݛC}W}73 MfpMt:]N?(X_ny[cC٨(YXn8pUks7RyuZY JdЅ:-u'B+\2i`hUll5gdzѲ2CwXcĪ}E{A3='i-z}5Uj6;Mqwv-8N {В`RYvi0s{J~UN6.";#in|;Y 8V[XPۑ?25C2%3P\jnsK4?C1ޅH}$5g鏢|\:8jIrsv,J{kW{(U_:FcUާw"f ~l*9Ͳ~h-OդX+T,`pѳIz-tpd&'9P~U-ݠ{gEnqY (/& ,>SNeg\:b\UUqZkow$({i@6邱#O$Bm槕K?4B:p-IZMt x#:U'(ojbazmi"HP}G 'Wt@뜥wV)ϻ: IV:)O^H :p.Wq^ցyN۫'TШ7n=Gϲr p-{<}6r0 CX,w W[#k+O6]]C2EgC;>t*nl?M -r_GCUs7]e4*t`(e4Q+ZWBͷ׹j~a/!N >*?٢U0oʍsw}%p'W:jJJ: Cw2Qkw;j-W@2e݋~f=lq#2. @(}Sz4HoUBʞ9쥕f)B]ʵuogV])ۺEx洺g6#tb.SvFLj0C 8Za8+qxU0q ^\X*OUMk{ ^.cnfhvvUIaGtGQ~A³R}.UAFNxm?m@XL5V׷VZgMy-6sifx(?Dp:*اcQd 2zy {.gHlIqY ;\ Seԕz_VFR%@SV~7; s|R5H~%ݾ*ݻ)I*@.g‹r xkQz\o0jSQ4~:A/QOV<5RWKb:fLX~ YN ~ip`ςq߅C$+?5~-KH!EW]ڣI[=~cnj;*")ͭe:u@}* uWzuՌ@U kD]f]Je@בDx_,vnN T\nC=Ưl?E;l/>|> ;MWܜmnOAȷݠՍGJowZxjtX;U'=ⒿʺKcrvףyLV뵳FeB? ޣfcѽS7d>V/O]望sIѝ@Uw^[P܆|suX%x ]R܋=wbusn5Vv5W:6clK\oXNf_:jIBgB5ge8XB@F?q?Xwڙ2qlskRP6EcjE]7^,4m {1u~ݚ -{é0wIDd.mZ\ॏ1]prz'@V~52֚H[O.+]i% !VX^v}xYHFsAxU1mfѣdƑx9OZ<:GRqa!v3Ƿ\ nc[4m+R$h!9㐳_{ݼs{Õ1y]Gժp h*hEB?cv-c $-ng(ʯ?IgX@eaԽVF+ߒfU-o{JJ ' X>:e*>'E:۵xgQsCZĢXڼRNSk>%*薃fBٺg3 ZAVdY嘝bu*z>$lw?q܂/0 q,1X c pze0v6?Fe;c|; c2ư:㤞Q;)n}QCUMqqI:n(nc |uUiίN(,fn+2t|tl}r,?|XgYϐXkC {~e1u8?GȻXcca`seG"y\4 (ٛ -}ca| "֟U~IsѳgX%p܍}C|zw#gQOǷ8(`XϤְf{Q~ci/#%ş[> ~Ӛδ RxF6{I#q=#ʙ5]*vzlX|?ꛁOڭ6;6aʷnPx[h!5{pÐ|8rNl 8LG)xfɉ n hlY1N܍YF&~[wjJ !/nѡVv| KVEGҨo=66 ޭ}Ǔ&ش7{uqǒ?%iyshI6CQ,9v&]d 7VMcuMOposjeBpO! ͎#QV\$x"@{C!]ܠp:n3H4lU6{oZ^Y6S31^{-<I;wcvñ@~ |)o?ۀSD)a8ݎ};5ɵp`滃06[e!Lb\ #3Yq 0rB֗Uf$ʸ|PdQ\N |<I˶H5dK1'֮V[ BHM%sNȩCλg(;?\wCǮ~ݻRː_gquWW-3uGW.M콂̃${>#X6wpGwI ,;\ d%Zǯm<2zԝ!~ }L~qYi+Oc;]Ÿgv[lxU#ykUn jwfO_<|7nHu5՛,mm/yRVXv3`^)hNri$56Ƿ~o`>ܧ i :ggRgVƪ'4mIɖ@ 8\~_UgJ")0&v <#ef6cAu-QKlTL\Fd}'J|buGqJJc]E FosɭG&Vm0ߙUo>o^LǻZK1>Q+~C}mߵK#wo?3kѿvwI"эϺưR~.L[jkpHv7.b&6X6ZߤT'nH%9I4n@vߢROͷiY^F<0uvXki'̥ >[ 6P~Mn5b`v"߱%ZpcÝQ=ω7uz BWOf236Ѡoڠ:c ZcfGrO.? Emw $6,swos4vusU_0@kG5DE~@W-w)WI.,yQwWi#e ݧ^is~Ѷk|{Egq9sug?Wcmh{ R *? q,.$4G>(.iiF; 3l hEɩYQF+tu~]=%{)WM%-[Xy#D%'VțF>%w7Y[dُMS<;*42@PsE$VGoY+fR#}TK_p΁:.?Sq;Z;k/?JP,ij{o^wt}w???ⱋ[˛~gG;mhx=LXk=ǹHd?GeB-2C58c^^>׏䫈yfU~3'C,ǩ^ℝufZ6__ͪVx>j>'aJ]PPgH¦7]fePn.WhU.<;IRLjGtspkaxUn΍+<|c =@FQ@|nJl2j-Jne{$xv=q!{kS~}06ߤ?WULa|=e. ^6\9RLƼa}Ul5HB{q)fTOܭ5#8(9Ys I%+C, AQ*ٯ 55%V#VYsJ}p+ D_@$n$yW۴ ֊~nBL(uQNYSVWc6٫6>%UUc%wX3JUmwgf0u0粅t:W]h2w ZÖu/nS!\9G)g~|w*](tw 7V }JoqY||*n{KN!Nzmk`ܒm><6`߽&T/ A(M6Z?L myOvQP7Yw&f VI djx;y#z.;k]TkD'H?e|oo W#ѐٸi?5;|AqfSe~{})&>MtywMOu&k6=\WfUD׋xEf0;uq: `6Ofk0`]8B2)> 'L.K$u{Gs Dlc?x+i0^MA'ȭl]Xia-<`]I#0aQ9P!fr\f8Yٔ.sONg{g(hYV ;+JV iAn&:Fzwg Uqo$lW&{C4hS+g  MܪXLZeN*iw'(p~(j$4V[GhsbP[g0F{L s=IP77}eլ;}Ϗt&]Ժ[ݚ{I짇h5j>H@:Rd&pQ~@{H`$ӯ9pvE/ovhuMFGe2GWGO{1k9x;c[#c#B5wP:%,?k?01[M u {/a)]slM4kuC?>J/ r] Bl\ M׀IE,B ѿ$< d;ef<Jdž} X{|̲k\0qۋ_#Tb xvk~ u7ӬOa n< u\ߵH +#z׸EcҺgڏn7ԆSۋAxR*`d~##^x c`^u)U7M}!6b!{)f㱣hԐ5h wqJ=E=x԰7{& zPv5u#GsPòg+:xc8o(en;68hu.Ʒp[],dq-Ɵ+꯫֍Bĭư/>jAҩd;}>$]1S<<+t WEd;䱜ļI+cU㏤Jӱ]AGk{njdhSK]gaFSKeѱIɷBDF^}V v_빀-E~UI'keK;WP Jr"=\Md4(`EL<&NM]*U_K$;~Nt9 me]S q(1vVM,gڡ~Ll4z8fɪ7WsV ֤MM aLcxc3POcy=YVc+`݇;t1ջkkJ&mFTY ^[6B:ױVD*;,\>Э>5J4%db;[G$ İ9߸DQ.Y v KnK8<]&G%hv;,@h^PRQ Qf%_$z/8*3V^SNa\h k%9StmiI]Q?}`]?ؾ>#S&5X_0jױV囲('Uw=O#b~-~u,d9WOغ{::ec"S9rJ;6W'E:k77Da ǀ՞l#yծ*F:cc! J :hnU V3ͣm4AU)*˚4xEowdQn28F~+U5z97U΢g,=Cv*q$gp4G(uߺ՝Ef.+Bt׻ AvCcI]^xg84IAp{G%,-\aKZ0jC8Ym~~A ƨaSI^*i yqK.ݣc~ c0M|mߘ>+]#?XJۨ>~}[4Uh :Tx+ĥǤR2r6|?kuy&.՝s:NLJt"xK*N5 Գ/ӢgrU+;WkifuKk;5V۽q d̟#VZ]Py|] a i7 jO`Eجh8*X]̐jK=qJ~)u?aGr$JEw)(eL4ߊ\5qZ܌4N8z!ߚaUf#KCuG4zWc0X5O!%JG X[i ]إi(@ib'Iy~[qs?OQ,}8;trV>0q/-@w-wJcr[[L&ւ4#[.brq6}o|7FVǹs d٬|I3/1þm.~ry쇑5D6dGen կE7uO0/a0r= v\Tw ]Ukkでւ5'RSeVGqCn;nkCY2$*yMsn`-F͢/牐z#V;iA-CM`u, +"|͵۞Wk$vAL~ ReMRfA4X8ǹ]l6UԬ)H-=Y{)̕wN>+n0+:Ʝ%+^=&HSR J/ 7k4!)uJ %4)dc´)$M䜍 )LI1ʌR'_$RI$0R*$BjI'qD$$IBa)ȄTI4nQR#%)$H$I%E!JRI$ ƉA$$NvL$uIJI$)ƩN!I$E2sa)RI$$"I$ShQN%I$r}*|=zI$N2@U&tRID%/qKRI$1:'SvI !81fHI$SaΩ$H:'2K(mrpPXH)Twwdh!7 $Ć5[j6NEI$LxMBI$IJI$I%)$NI$$I$dI A:JRI$R)JI)I$A;73Q7GU{u=Nl꤯5TK|ʐ~ DPBB k94(Mc8ۋUKc ]_ĔX-mm' FT7aNuW6wm#B UnoyUM Ho{X: ʤ /l5P#ݘ+nĤX5UlgPD1}Tʭ6[v0CG "FZ˚ D)rXaTZ_# zZde;ѠnSS'5NlV!){gJ,+r BʤFer}\PuVaGE?Yax:]}8xVCA%VcH{Uᦳ*}]ݿʭ$XtڈKq7[;cJ6ߣw% /fCwd)$c0*b97{l<_emR%.4oYQR#llV=چc}^){+xqsǦDp꡻Z'RO Z Zݧͩ#UCtbNH 鏒s̓AI>l{] ^;-ѫk?o9YZX*n^K:5ɵ%y^Nl {eTM+ɒDI(I$k^ iЂoWhJ f?Yo4T -m'hԔ](UU`dR^/=W[X#txZռH 䋐 sdkHee䱰7zO8?qXbc[O֎e+-64C<<.?FsO!5zZx($JbI*X-X/ך6[~gT2Y.?U#Ok?ILnѵڰMe{=3 7m |*k0[Z10)h?Ix$q]PBݸ˵'g r, 1u;Y7Uj'Ih''nZΣm@ ùMe&g9oE$hp$$5s8<0:q7 '4 VُyǒT.il]#uPdja!sӆP4FE٣G^;wcĪm5뢳an;DB%naϽYc[V;@?w 5Z +q~u@!$wsʏ?F< g^PegBN+r[OUo9AlSU/eaФ6Oc0SWqw(Z=+ Augp f3=K*[[e ~~#_=JDDTosvoae*2 hsʅ4`v@熄^c{Z]"yqs8CaVfr8hQϭ%9.o`?n2 !* E[6-l{]⁴BVc#?P<,mu=!E{cK]H\YɳbYo ^s(l%[ZmqЏ5\dQ,^׻+-hq; L)ZO {}zy9xT!Ʋ?40cyS:\SB2(nC9kZ}"}nwfQάQ£Ň䊅wܢȐw2poid~ڳϊJ;p(m#J+*^>|u,,k|J_7;OvBJ:xDQJ8Zuȍ`ru }[ 6,RQԱˏtTՍ<}6Xo1%ce*;sow+5/!JJ'Gw靰vGX (cEUse[]cdda]21\u .?/sZ.'a ?z.eVm;Y-xnIV3Ey1<%K`M{~OR}ߦ\w& JaSFd?$lʝf 1>^UpӰ-mxc ct<?kBwJIٕƊHPō2:hkkNF=ƈ*958=Htr\; MyA:6eXJjȤ~Rm%%O1>Zw1l_Ն 1!)tRFKc柬eXwJ4EX-V[ l7JXG0~WJ?n=Ѳz}=Ah ;U~]w{x2 ;7Gs +k#O uevrSax_a?zȳAΣWڱAI#pUm.pӸBJ;,lA@鿎3CF~!mfJߡ(]Oݧ:=C7x< %nX41ʤCPE'B Og#Glʡ#'FGӬoOϯE ='U)ǺN.i%w+C? '#%te;0VrDJGaq/5vxul_ǎlwQXl >/ʶðhWXNvZ"IsJ']Vmfq[vYWGf"aAxTI,qs-<򒨏4p` Avj[5;ȴ0jQ{{:K`֍a[}uoUo@#ےIPx(>{kkH "(tG{o ~Mwn|ty/ (tSÿxGܥipK' VO(}<$䃑9sZm?ZT:=ḃ^\;d6{<Bՠx(̓D붆[n[p1ݗo<*X;eLVM4Ĥ G )o3Qǫu*f]V52uWfh<d]-\` ݖ 丱@r|UmMKL jCwY:l:vm\ 2KʄD:7bPW=4h nOГ 'J+P6ĭ{eY(+R qXڝJ|rQW(\w:ǂTâܟ%ce#G٩#gn̪cDeҪJy%^^ 3vnBmxT5WTzn9ȳ?Zl&\k)fy{#WӿD}$KtDF;5)WT~ϥu>,fҦ%dzGecV-1G;O#G +uQAo^AX~EXowQ[)nxc7}QcY|V=[f?h WuR=<6t掬X;2w<0K ;$H3qKLȘ&8-FqzqHF.۟y qVNZ Z$uDcC!XkCFw^Ƽ"7dS2U7e8DX3Ԗ8mL;j`J u> 2]s.2q7uOz7?+zEbMb?(wLֆcG*wYA :GeXH'T^C?Fgz8.%2R1e  GƼJ0CwW=ƹ3gT:c#ZgK rӚ Tf}³F@x6McRlWAFfj[Enߎ4I VTiAggp~5C6Jۂ~Lj *r܏O]8wj]R6m^չ O ^ ;h5WZYְx&zy(=*ǺJldP\MqG{GQ3̴V9qW߾QǬU^B 9uVKl,>I-=`m@];u?5"ELGfrUYD*EQ>*JJI$2gו7PϒT铤:({$hRI$xD!*I$"tMuH):ުRI$M>)S)ԤI3Q`B I6NBRTI%x)A I$L(9I!I$bxL*RI$&$)$R S$$H蝚NԐI;aʑ(I"5H)E)$N@"6JI$&4AJI$Lju*`)$QR=7tI$a2rcBI$BD@H %)$NcS&hऒIRRSb$Gs)JT %+D M@ vޫI$.`uXh*%%I$dJBI$J$$I2 RI$t I$2JRI$2t%)$I$:JRI$"tI2GGIEHhBGI R-I$PZI)$M IJTS$$I$CTI$%)$I;BdIJI$[‹ $I$iI ARI$e(MHRI$dRI$NI$I$$IBdJRI$I )RI$PdI$IB RI$t-ȩ_㿬*"ܰm&!w AA$TWI$־ 9h_ϛIC7S5:fIUf]$H$H)I$t$I$I$$I$HI$I$JRI$t: RI$I$I$E0IJI$I)I$I$JRI$b2JRI$I$I$I#jRI$p8O RI$$O RI$I$I$2tTI$LI'I$RI$$ RI$$ I&I:dҕ$I)()$I8HRI$I$I.ڐ %I$NL$I"'U#‰R )I$EHn)RI$.LI'' $$H)JDhI(SNy!2rI((ҢIDNR$H' IRI$9:EJI$IRI$tHI8)$I"%7I&>?j5.xHjn |ݹ~ӱ56oaU&31d"݄j1ݿ9"uUgk3Y> ;l} G{C*rc* o yH,n hToS{Qгu_*їm0t) qᯊ{Gc_L[@wѵFcCWwf8M_$&| l5ib)?-%lpGx*)xd +\hO+TPfl@xWc6V6C'(ލ#u|QF .N=3RFʋp'W9+;7l x?4RM\{QC6 6y4wGƉec@9@K䙷لvd{Et#PRsC$Q5YwS/{'e6ݨNnB~*V:q=L NC.gç%BR|kt?{)+eppg姂i4v;&G)8ыO͆O.P0mc}7<LMޕCum e%/+N*xT򲛎5rV~f#cm2ЯbDai%=KAj64*7qec@9Ux;)}2_Gcݪs {0mίI$j4@p ù ;mm2g)]Zv7ש2c{$ޡIL?TΤ}k?Gw?#ɋn[(æBwP'Dm7(&,9]m .Y'иl?5jٔN.h;7ILaj}x~qe`~sOޜV7o&Fa(?V*OK=s]&-,|fc7k;{[6+0~?Eqh:.)J_a}MVSx'_շ4<H=[K/ieZU6t_ȵ$XxWx!yùf*PY{C[OV}HQCE4oaܣӷՏSdX\\}OS'u,csCPϧXil|=n;=7%4&YxTpk4j䌓q`-is/n̄ Z|ߎ~?mA<0rRJ,NߑS/wIhe,\ Hc~J>C21!fb5,oɤ5Z6?V5zzZx)v|Sao74VUKi;59u%ǻ⿐42$a(4oAw(k,.;uCm~C1矀P237{zj6muILA|u: Ss ~kP:fc\q"{,Lvd q td|52C\5 A#aGP}AԫD==.'CݟwA8L cv +eFH4rjG&_yM2 J ~N$1Եr`m\NT,iŮ&_`Â?8+= jtҥՏϐWz`>+<.7ٱw=ZPhu>޽X2?OcNM7T2nG (hhw[H9*u+;M\V }>^T0q#~c; +meU}lg)s>8Qj~{U2IWz=0X[1kMXs$JV )9IvKkӗx w<tzp/*=OO~NUNiȖ>5&*i)*>^vT4Ew<7WZ~?{Odo < K+W «|Z-#@xhi(]ND*oyW:> Y|J/X䅗#ĄaH n]޽ϰ?iLucWYy o'Dv㵬51KL-.lcuV6M-{ޕߦGI2y)$)e#C'^-isgse@ȨUNtC~vhoW2qROMZ5nxRi[9C&f(sщ^]_YNe>hS$ rQefMշifnCOsGmq>*UFq(3ُm`Ę/O dgW\X$;w,{KƁ[DɯWJɯdVi|QŷR+oȒp6oee5UXjp5ihpF%w0I>+k-n~ׅf)庅4A=\-AUo̳ЫK_Mg K;*YKnMCO?Qoa<}槒b|zSyK{#eK?Ȱ.>ˋfI (jXbVaY$V=AEm`H9gQǂUecfli\ɓ[43 \>P?b<[U;kO]U.{1*WIuc;ȎB7Pe6XBn:k]ȫ6ѽ撼 &}E}\x;BO {>PoIXugb+}ɠK!g$K-l"jݸP{L8%^q(Y6ڳ.9}4ՏKtZ-E5YCzzJR|i&<>A5w 虒 #^|ţ}<ˈV[s4V8IT\)&ħkq; HsO%Tsf7-,6YeU?$ms5 ovU%|k*Vq5FJsr׀6R'Va7X>X_?CݕMoBHY9 -֝q$O]ܔoGU(v&y%h7m;U2: zVMq=ܒHYPDFcONO܉֭_JD~+O8fMcV(̱|J7ĥw?Kk&6USAcGu auZ+c#U-y!Gz dl;-oc_&OxD&~3XkxP' } XoL2*ww"Z (vIXfP;!}}[y<uF$w=9f|zglcVuvP=<6<ن̺O7 \q[9%m~mB"a^wZg˲f7O1N[wL<+#HݓhCfeh&<3dۮ>e~,^sjc5|JNg6W MmJ_?k2U^x.k˃y=N=_IX旯?Eِ@۩R'58רrͷv~I qW?iMUYПsrqu/ԕmgenV{!/w8A٠d:~0a8buR5aX`fAY=##R77$} E>[ljVMv4 8;,k}`-pOu;un-#ۧ:yM)#C恙/V L5$*L(]7+V Pd;gWI~?spvFugM{$F;}Ztp"ce9 Q}^?N{rk8dm݃'3 ؎&A@3̬G+nEZpࡏ/q-T댆ߢWoǩ$<};O\麧rƒ[\DwͷC -3k-.C.0Ia\bJv-neu=F&h'S$x0(2,qMkH'E[znUH.|Jꔵ5|v֗]8K~%Z +xu u S%9 %ôS~RI$7B@ JN:b{$4 &nI1Ni)B!JI$C'JFJI$JDSS )$HWwAPRI$LRBI$JO0I'r I I$#re1(I$dI)0R:$IvhI$r `RI$钔)$K$RI$AtoޣjH 7pX?YZV6S{v}ڄ]%XiUҨߊ́*eY۽?Dk'+ц0n7$orOoy6aiR ?4\67}9Bv1  ̣]4uĸOgJUl7OZclj##_7qzp`8Ζ3+IT8ʩdz ZJ'^AK abX3!xwFmc:!:$GS١o>ݝQZW/5e}?~Ԕ*˷C>vl;[R{m,ˋCk !kRZ꠷"V=վ^z| F˙$4aU\ 纁5Yk>Ξ!,}^67X4 ۆBןumNJM?J{jW]sOd]U[&X}Too7GC]{B\Xw7Bcʢ-K?j ӯI;F1g[|hH KO6G$dWR}-Uk FƭrJXR{'c %R *U]fyuN:zšˇX{W m ߻#dLV\{70'sO(D#~ٳb&},q5k"[n1)Z1cg~m+hp-py%oV47IxJӹڅ<5 UbʇΛ%˫ma IiFR϶ -;\ 2Vv֏Qn0 ;FrTqqzמx l`q׆Jw=6hʯlwڎё2Z=Mbm̥hmU>ǦH;; #m}zz'5iiqJ3-n(=TaGǹ B[o8}DLL[}ީ]ZRW?ey&k;*/aYE,;SUnO}Ce"]W V2Ջ}K|)l̝GjO{ ]l~m..#1[ W8'Uvwȧe` h;ANp<ҝ0qJ%~̺\]FSqs[>q2C̒k2$LPL?y9L|9>H8wGkQZllG Q)YY B ;n;\^FIAQ߃ئ{YN`lxʥ>D6Zߤ?G$dc+W7U5i਀\`jS2H|:jZZ!;$+ #~]ߛ~Q%G[<{5uU>k߳g-f;Oen?\P?lU?JjS饴E/$O;x>O@->`JUEQɛk?u [es ̆ҫU{)2ӣ,Zv^ҲjƨTyi GPOuUeM7 d|BFK1GqJJV6σJ:BMyh1TgnIKmn9Ʋ@x FOyGՊ.[_߿bfFx.IZ0d״.4zty 66Ƒ,XF}*"Ohml cӍ!%nws:ʴͥ3T. 7G I}=ISeSg>+17<7| 6S b=h\:.Qi R^?TX@p'U~oLfd3eG⥋QVyhpwh䤎Wyh]έۚk OEF<0rUVd; YG;/J,9E#ߖwGgb;>Ĕ5ݾ g`W@O.J}qT5ka7c0D;_Oz?OrOYO !l`yIM}I7[oڛ~=,CxVVӾnMiScOuW>1lэY`Tic@S"EgG,hЁn w(}_)= )*Ory&|@/05%d3s9J̓T78#? -PX؂~SFC-$o+t;4=GScP GcT2GssUzzvIy })Jhd3[=V\euN.*8MnM5sOs kC5~(x 7V;ck0Ze 8bIǒu_d-#9#~s@ cv(dVˮ2'&};?Zub&kG+E2XZV:ݽۜ4U9[x !Jm<q~ڄ%hu7~%^ʟK;-//VmY$>;D1{\aC0;U}zs^=|'H!Ng>% 6;ppGQzY)%%vA4^6GQUǹQ{-8Ay(?ѿI(ΛGs4x/R˥BJUh{9'yO}zQuʪLEO5P%}w2ۑYaIO?$p4*k ]h#2R˜M0p~K69ݖ;撼9+$Ȫfy=$ dBVk0s xؕѓjx.vӕ ɪG쒺ܞ:kW L1ͺ<[,[ðZ4QZ, j+ۋ"K˷{%%$y7!zJ(DY$t ޱfOxnFZN鵋^ {*ߥ#gIkU+-eb\aq!|ժF6?-uV6bmWe:C\}!Z撬NUSLx.|k!Uoͺ/y+}2xKyXE7:.0ۏQ#DŽ#XhCɭǑGԹE&8Yu*jwr~ϐtBzS촿jN{=f}x(EC;z_߹(86,4L[1~ ip*;:I\;+xT?(.wlV:r^ l0!\v9EL׀q^s> Q9vh+#>Ց>EJzU9_JG$SSX' WK"j>8\y)U9GӯJ`*LUfOm]sN%N|lqPD}gB5 2­/ÚOeSt+ V:vYY햶 Eg5쒮,1쉋x{CB3\%!_- 8*&[l3n5}RG󃐁k~чo%k8VX`Zq? %y{kv:.v5BӪ72שT>̖}YAfq_8nx*3'] TXX}'˫pߤBEr[?E>G qyo`e\ ]]Y-t̲YƣKFxZ]_)eS ={ҝM#\E;YszW Ala)R͌KjQp}y> :1km~&S}&OsQīceHzga &< qXV]SPIJ+bzx5:GV։%Rg&sMN̍\}T ;>$&+S m,5ՒӣR =ڸ8(<{A`'l-^ܝݜ Zç$r M _ ۫4K0~B&_NTlwĭ\G:eL,2rE+oP:* Uh Wq6roV^VWMFCY?$^>4 (h #{ѓl.QŬXJ6W{Z馈Sv!t")׸\Tۋ󱶙{+^ΞȠ],n=[(@ҭctn=yy*]5K 4=JwTXq| i^dٌk6ېMC.w7@~^ &1`~$omk=%OkzaR!L'c&<& SY,k[P0}/)̪8䳭X+0'+$jQK♮5"$s.]Gkc{kNGe4BtǓ{%uc[\S[A,hkY2RpxhJ# Əgo^'XFAhEAmY?a*8Lu?Nc=] ⶡo?Uz.3iaͿFYn̴x<;¢Ɯ ΍"e\E,Gz4+Tg=1c5d]o5S,5eul&l䯳fۚZ{; V2t s\IR鲋YI0P#%[7O`5A.fSkjce v']Shi#Xii ꬼجl+X ! yqqtF QF0\  71 ,juBpil}9eWD~O~}UMTV xyQkwVh'wp[930y0uKi&R.RTI(X$@)PiJNISuH`ZI&%1H'ݪxJI$=u2TM0$I%2S$I Fv@:$$IIJHI$qatI)*1))I$b!4ra/4RI1NrI$PNRRI$;uH4IJI$!@'>)JRI$tHI$p8 IKRLPI1TJD)$M藊^>Ix RI$&D%$%BI$2A.y"$I'TQ 0R$H͗@K*\BlӺ|WEbH?J-ED΋J$*BoV( I$ܥ MBI$2rS$$I)IJI$I JRI$S$RIJI$JpRI%)$LbR'JRI$iN$$IJe%JRI$]'()$H')IJI$e"ܔI2e"$)$I$I$I%)$NS$IJI$R(RI%0L;I$I(RI$HJRI$:E$I$I%)$HNIJI$LI& 2I)I$t'IJI$LI+K~*W8ʮ-ȩ_㿬*?,?d<A'pPI$FeI%~ 9h_ϛIC7S5:fuQtI"*[n*y8;v[8?CL=;X}~;Yx NE#"on*UvZӻ6!4O),xD)⸿[~k?LjL}@;{q_)OpѿHNYcTh5"[@л+Vښ hht#saIq.:$R@nD8rNkNPÿ5u,, Je]9i'RVӵa  \th֑=Rr_ht%?vijL{Ky)"9Fi`x)m;쉏\2ruX$*Y,oA=F]c?0'_ )=:ϊ+{Sv7݂eRw&zKC!Z6@JWj;R{Ω!ߎ̆lHUYuDWwVtmɵ^L5AKaӪ!`^@'uSƁ?D)E~%ކ?Yl^wnA+yx#t2c9hCk:Vqq=lykwDf37|OFǂMs[^aTx )eNp!5vpbzDas>ɭY$ HIT}.9KԈ,nr94)P!}F/:?Y+dxx㳻;r5XX;걓܈ EÐZ@h2z۲~O^e7;Ha]O! }$I*mQܧxf]e1 ~sxmCGYTms_&D?Zưmh8$khnژ__Oę&|(f;uhM܆ôpծs)WiQOFKC#K?4d[SmiZyM~;r#NSEY#II[H+վZw4,5z+Lm`iYAGb>6ck~RYO:.F[Kv$hk/5pPcD3Y]"9Qn3 2Bڬ;iETvCFD>GM]I;c\J)pmf|>ɮ;#li*.<*\]J Pk3pmvri's{X?k*vԉxVw  RWGH%Thp=cVQ8ZP>rFPwqpҿ-ǹ8P0rjoK7X%٭IabWӠQ};y [I:Љf'9r Xp+kԱpw{oX$c0ߙR} YW*6-P ^u'mpGgTctsO Jl"ڎ[CRJ i5fZ~L-Vj' p%ޅX8=?y>.XmI]Uv;P{XUaOmCo_;=pF<,Yjsq+.zu*7; ‹=]NۚX 'oֳ_|zJ;mߤgu;Xe^ϥ(`8XAM\懴iuلb6xHĕpmv7B%6,YVrٌG%G[g\l!I/yaY{SK`$umAܩ:6*6߼mnZa h8%6ݿ }A3SIU6`V&OV3nDm<d׋?"eùڕSmJF;r| N!sh)d{Agi+B{JV^睴=>R vUYDƞ ˫vʴ޷sxkC?:Ya)l^,*`p% 4f|P]}c4z-Y]zenvZ C6۲JdgVwRc˲y:mw$嬹1s.+Fz:}\e^6 ~U.j;%~!VTDmKӲ(NfY,{O!O&kvt6Cǹ=$MNI_-}6{PeI}!-L1hv|!V s=&OJui=4MRW, vkY쵮t)8}ÇT_`?I*v,草]}$FĴ` )%?kĤ1p7OPfAҩl5Y ߳׊.*p0?cc>1 m>J:="ׂ4پs _Oď^wؤm^Jz27[`P|be|gQeQ!33%hZtaYI[hveebw u.b]e>(R-~EGKpUλ_?W }Xc'Mf7X҅I6?׏I&nF%ǖݳ)Svli>Қʾ͛|Ge^6\<}5y(1 Mw\>#!\e4U(UB'^?cfzu`!cjA 1'Ĕ^=6 1~M[VQ?fīrqSf I5Y69?$g84x4{hQ& [SDwUdb*[>e':뉉sֶtv3[5)+}z1iq+ AvjYYU 5V;3ok̗.q[4adIZ%;F0x:hZ]#ծ]sVc$+u~CG`/nf/mãJ:L~tAf+ݧ_%6$"u-p(] A*y.>.mx5%uZ-,\0X;S > uj$rSeYA7& :֎\U 'ӳ$6"9MYv׉'E̢Wp53}&q}ʛ&_s9ugE(z}3y9x!ДQcmlÇ)[wpXx#U l򛹇Q^cqnE*8e'u gX`N,vcvWQ^9(nk*ѓw+X7ZXf,FA/EÐUMLhՌ\y5l|ǙD}2[?r~eN[p'Gk5څ2KJ-ۉu ;;&dꃆpp0yD߫4ے1{ho?mP%w&ULh쒷C0c}& _x!9ė*n|rU^ugWh.Fa(<0~98űIw 1X\ÁE7F~U:/h[fC%qv9wW4<T}.&D~Y $RKٽeMvVZwo5;W`\aE^洞\rJۙXڷ?vg [gRxRl@ԝYVq^O\WŒ;MW8x+8fimy&!7O,j`{>v3hn=kyM%NߎWRE{ԯ/mna򣑒fyWf=g~F(NS[0U>R5\%#5`5 fxVO=°Sv?Gṉ4=ZTK\"XhBJ^1sk%*م5c 5J=ӳZ[ ;\|.1`ԫIUp` RGF㺳"bVuԝ֎-Y6A4ZMhE@ŌJ7Gm="{u%4 |X5z]謹O 5\$ _wPeT> Yyv}-LjU;p&|UVnߖiK6+x^/Lns(XCjs∣eK̍+.C,: V--;Guo+a}@\;A$m զXu⵿KRjomލ`lac+ZƳkѯ*f]ÂH;y#Hx#:9XRtNnX0c|>рɀfT0|Z[Z~y+qN +<1.͕襌"`n Jղ~ѐ8nUʨSK, nng7z!% u)qUޓtGW84I*<8U:PV}̬|wWX]b\Vjl)1(۸" <$<*~x0)GF]^~l9/q!U2eIVzMPgI7zoFeh"1C%hu> !Eg V^nxw~NOѸ@P-o̤ ݏxht1\JG8>tw厡I]U.=#=%ql7)nT+,oZ{8:v+K\7:p1]-ʫRws,;lWc8wU[SJ,_Z}ߍuh}~6Wﱞ-CLv⁑w'qٰ f}l>K~ "հrVju;ˈrTz OzIC@Uh@{0u*iҽWӖ$Y ֳgM2]Voo44 U>'T|6HEAv,'xE=6}:%sCuU]m1!%x&ƉШUyT$jּ;srҳK7!ǩ` ;YIopVZ*tow75Mc 4YPxG aeў߲X^so54 {6i}`z<$TJ+nܓ(nZ{N;K-03_qs,ԁYYY6kq粳Н1LujXEa.λݱg{]+4{:sYU{G'DIѯk"ДSCHy.p^~>q⚫oa%fakYADhz[氝㏂ǽ:0xDmHGbE=UG-VzF=!ި|~ыۛPPZcս#^p0Q.f7iy7hA.tۛ}Fk&AG6UԦ 8895Ei){!)1斸k ]N՞ N=‡X~=B&-EΝwՅF,u/$jw-Q's]ӣnuބWR?${{1ˇJlFC[7?RS*aޝ yeN`x*3}6}~n-qn=M><;gͳ#R ]2 J?*GTQ >(_[[ϴB4 h2vC yVMSW/"ǐ YXٷUc\NyIF<V9>(o:&--'OKo@wr}6n|j,a;Lߩ%.={}74o (dj5 cX%Al'h 78z'c|s2p1vC2[0 =ďJ +/fXm~y%K-^蒞֏7O?0}-S+7tµ:+Nh0Mkt%+0cɸȃ VkcG^p#J/6~Xu5Uu I+N?e~uD#b}7В$0r osjlTm5nG7LZ9OҰr4`=3_mԓ7Qw^W+}'%qIH wjJEbN<]4pI~W$c7fgg+V8Ī"9'VW6du=`N8S%[b7NJ/P9 2s]=¥vQlcct\l gxΰW#XQ, qYٓm_?!?t6;o c~ˡ65=`.UU?pAI>i(0}P]` '88zx"YU !ݹ]u&zWigbcuGm 6{1]bvN"B0-,ڮe xvǏW2Qſ~iO^k>ϓ9PķyIzdl{/I_&=FOPg q%.@I-) ?Zl0ÇwC5öʒ?\gQn" Ġ;>mF;pt)G{X֤M1ĠXZc0!t]gwWOi%]XAoxvʴ8{V 㹸sHog$7שY9wtᤰ=O%skǂs7Wo0w\8aum{tUݼTXSPZ=W'+J8lu*QsgP i02t8nIFG5 &J+h6F~iwoU-knW3o$OMX|@|Tٷ=r?68Dwy=zЬXʮD*]Uߢi{* ;,7 ,apJyWIAY³ޮ&WhFB9FmgG8*} t-Ugo`ǹ r 7VllW13oh~kFԞ##_o)߳ ;(6շ;{V?EW ^ME qj?u%]s.8qN?E[:WV~cz +fZ2= F=yRmw)͍{+xMǗI~5ԭj0S _xW_Ʌ"u@>ϥ$-n糇egIǗrSg)LFZSWIǺ.㲞7PVv|S<#3?"V2@k۫^>Q!x|[4;٣ILO'*vGby'U:l3vG?Jzx2?,"}ԿkG$~c'1$y0}>jq~[G O dGt,%ݝCQ!o{?o׌zCʳj;_ӌ_yWN㳒[fuwS29~ @ʭ)lmaA6Tdh-kgSDi ASy$+~0w⨾3ϧI-}'w*IEћ`[gx sfY1~w$yC SwKcZ=YkxwO8YHp㴛O gbH_kGu>=?,]CgIڦ6v&N˼?_e7d>;D.wxpO.~'w!vko'a$h_YT_q?\* N:JJE?/6CŖ7 Y8fO5W8MY8 K??fvˊ0P2փ%y1TGQC҇UFrE^"$rv?ߒ j\v; ›tcڥNS>QQDu-g`5 Z<}&)Hz 'V'z{kұE*42V ~UUVhwg$DhoԢK#QU?ZȬ4AЂr1k@$M$?-A.'y5[ #0U cG[瓏@yDWA~Hǹ$6\ih9s`%IR-<\fD0³il=?ʷM^J`y3˕`ۿZ_3v,G!D[KN=ݣ̥8"9'U{A1TYH,%|w"Fn<: ħ}nwFut1|S_HUh}+\m M]p?MLA(X n|v*ִ3\p x}R +~DKju'kGl.YmM Ƀ&Z9!'~0Zoy<%jَܟjԋe'm_M=[Kuoc[ CX$:xYGcjғw?NW8Y!~K[X5\UN=MsJ 61aJ|&m. l9Ƌۛ<[*^3r[G7VrҒ Zy vT5*#c5# $,وﲾ,;J]~Ab?࿖RDNOO$^ BA-oq ;HgofnݒV߳՗=0Ш%GѾ]z{?IUnX6q hԣx^ )D 3)2ѰV >LbðCu  f]z懴A*scx?$Okrih~Od%8GX{X-J݆M &b?k]gW2 Q2k=M٣q(~N= uhtdk1)uFkVj2 O]:*e>zXڞ?E% gfXw8QsQ᪰[X.vo.NSqO<4rfSC{G-lF'W<0$tL˕E'Īm1)11r8hiT2IwF_rrېæ׏)%UKr]LjWGn?S5ލKO"(Kon|U5X&~r Zvh?*|{݌+am]IQ[ck0]fvSs1]cLoUxv?jmmُ ]~b.Xt .^V7?5fI25?{el"Bˮ[}K]t nu\Nl::={YݛWMgܪ @ b4moY2IE䡛\5&RE v"u*[n({EX]J *Tiq-"'TbU[{K{rgn%rGB/FomD]u J=?Ob A d|\[rrG9[뗆c7 Tz3OE*~ݐI]<πBlaLˌ|I瀭t[9W}#Yd۟vߑY;ΣxWFӪyGy7;o7:(dIB vY+7:Vpc[:c7ʺ~K+vc+vDwtof.&_;e#cG:ɗ_vC%t: @.˝*ಘXh.%i!5꘸Cf+7;gLoEZ*n%vO^;+#_жIa a^qPK m5әPW,!ʵx(r^CIƷ軅OK?4_fwOVr2GߤjlSp߸B`=5!~ÿ:iRvo/wM٬&WbGy2Oe{@JYS={b7q.WW"לD^S'`E Pd b|\Q+tTqDV$ z,wƻ&ͣW8.Ꮟ^3ytYSoA5цOͯG$4O`OCJU5*MN)]Y!agH I$[ sB%tSb\ʛh!ΰ:\Hxmtf0}TuvohXSf36ף(Uo;կ~)x+MpxEv<q,𧋑_U88+&¶i%mٍ6[ ky 60gjcCtxBaQ2[xnSTnܛjkz،yQGFYk#=kiNsOP3PV21P:-O`QzُK:F~rJi 8 M+B Di 9ܕqa"+egTAs]=U?stoFk߷wt5MUV5kQ$O5#L5ξѽ[mbk>N~됺MԖ֑$U x6b\FN-c{Zwv 3*})Jr=W#k=UmYyPs>ˍM?YeSvk~?V) ;߫ +!ٮxcmP1@LS 1n< 1?IВ <~Gwp;%+#=f;EmU u.qZח)=5Ĥ2ŘsGAk@j'.o[sַ_2etcqԱܪu ۳s-E㔒+f9y ,\tyCnVY[5*n+p[gq]wW {},o(יjփBO1Q5?]JmKHpUm,wvñRv5Z=cB- -6;^7bXx'qѧժeO]8))zs56?)!ޭ:?)t>G}{!FWpXoW[nKxm#<3- =%s|pZs1IfJ pri *P vu(Wx64++vp==7J$I*#7o ǘA% :ۨC+  !g54[}՞l*]5ř,'ϯˇnV^!O;DwUc9K r,Pd 7SPt;ۼKtGûMio 47HL@ 4JI3*ԢiITIt{)0RI$Sh4H)I$GTDJ|T$H-ݓ)jI(BErI I$ 2HI$t'< $I *GJRI$0HI$A"8I*I$Jr5? !I$c\R)I$~7%)$R)D&NL)$N pjEJI$)iPRI$e $J# NS)RI$#D?2Ce)$RJ &5IJI$qM<$)$EdTHt,AbH'se*pM'~+ $ G< o ʒI%rTkI$RPI&I&)')I$~SBpJRI$LyN򒔒I%(I$I$$)I$iLLI'L$$I$RI$Ҕ$Ir$I $R )I$~RH'IJI$LBrRRI$v QRID!hEDIHI0I%)$NS$BI!I$s I))I$dcJRI$IJI$'!I$E$A%)$I2I$$I RI%{HoEFcU%wVl10O#vH$ $̺I$־ 9h_ϛIC7S5:fIFeI$$JRI$I$I'I0I%)$N')JRI$I$RI$I$I:I$I$I$$I$E%)$LI$$I$I)I$I$JRI$I$I$I')$Nd I$N:rTI$I"$I$HI$I$JRI$I$TI$S')JI&I$PI$I$I;L)$SI)JRJI$S$$I8%"$$I9J4LJrI'K)"$I$tI2pRI$)$N BI1EIQ)IDTC$IL'2HRI$8.JRI$ S)PRI$NI$$LGHI$@BPI% L$IRHr*RI$IQJI$LBrI-6JtCJG.fUgcGg!kfM4Jtvkg}2!$Yȹꭔi?XUoNу}>[ِ70S~w;ԤwWlsoYʋ5F7@W|_E{P!¬?lN<I-dL4_5Tl:p9(YW6^hլ=G['k{5X#`$Bj*Ovk9Pe|w)1ݯ9Y̺iݸ4m.YGr+QV!1D'Chf/yqXtWMqVw%6Vo[hÔbن}L]Y޳l򄳑<൯s/WifSlr5?z YގP+6T8H+e,KJ߼ԓ'R#uzE-&k e`{_Ue,6ZaS-iBK}5]&5?zJ\vID/IֆN;.K;.: u_k4s{+X#70h^xNqqIT14a:X;ƭ4ϭ4AjlXߴ{-Ƞ@:'#B,{lS ռߋyMh%oi"Us.h-(9쵢CKRʹ8lV=ڣeNT\õܩfaէHDf3w?G.( E7Nkr;x7ݶGta~eI qD?&U"@L=gȭ  !_ 4@V0uԉh^y>?Ckg_`1 RT_7qaߪI[&gg!A |Qž4#"daZ;Xc"X}DfCwt;*Rp vXW^Zx*60v!wd9O.>6=\lV4q>.;(`ܒ]c}!%xXR6Xl2xy{=*qO>NSq-=i/?e}+ )UTl׆J @?-=C Qe"qS=-py v9޿%lK i`~ __i_ χCsLPe5vo4&Ppm~9 (w#^Q={#ݸ?ֈP ~i5v4sﵤc̓iF m{wf䔮}4csDD-4V 4Jem`wo%X: e6DmIN+r[ЍAegm%6&_Mv 7-+%ϋO5w;*nՇ}?suaє;r$1u%泳4no(5n=u Ruq߼q=2*n~;>Aӆ?嫪ۚX d,Wwvk Lts_`Up-?E8hRV oNKGoLpXȠ rusj0MC8YV\ Fz[C!t+m#}O$. SC1۱*Fj79qk?pOyN<:n~)UFq;X;TPn4pb@X`a eOq5in@ i*]yGk@ GwI=Ω#~s{<Ռkِ?XZ-(7;g-kǥov[v|bƖӡZ=+>'J9,arg2??0J]9k?+%nnˊ<uS=\9^#Np|}(1}]ٿ$,usW&} wXsN\^mxǩe7 ii%x&s+ n5H:覶IPx>*8~5Z6Gإm"1aQxE BY6RSX{$ %M6B/ًuZ ݖ6\rUm:6Yَ 2th5Er>䕺4nYnn}6{"Ukk ~cO&KA0鵆mK%y&fC3C]@b|moA9G]9OUp-?EשѐF8=em Ienq*vMcFC}JpMCի# '5hs,v#;ux%Ӝ7%*UvsSz?֒` wuNܓq47Bb3L2[WwwwUe- `@-rbwðU2U:==U-mmBeCaT[K~@I6m[ yUmhwknmFmyl- WTǣ| *WoJٓlc6` j. Uӷ.WBV66=콻x$C.ZX2mN\֗07Tv3e~׎?Bf;wX~]l1fS+IL !UunU]i^V~gx#j>Rv ;JiU{xȹ ۶?K3qoPG3R۽w3؏4nz1;ە^F.6he]9FuMEc/wg"Ř?t^.!1C1Ƿ?7Sqa᱌.gSs3>O.b溵շ%ԗm{ ZE̳S$ f< Ysx rYuc{<,ʚZ%vN86KUMuҖ"o{њ[)ωC9.WdΗ]$}ڞTً8i#aeSh[ _smZ.Ыm΃Fa>́E=W4Ӫ77tY-}$}CF;BYjG|rwU@]FX/sc*VȬ ӡV24eWeB$5lPֈnu=YwuGdV\x*[;1۾ַĄNJASPv8DB.X<²Ljsv}u^M}bgX75N2RQ:j]`0:5XSads6- fNY}*|l=ײz->sUzho3:֑2ẻ Ai!yvӻW\=,ㄲ:=w7t)u<,j6\8Եp!]I(g}d$̒ö65{@NGO⿻\Y6z90;93:9l;UC=Jr< tx uuzSQIh9Xt8pZίL}L0ng(dYᑎw3BJWknn!Aw_Rh dvhJo{}j7@|Q2ͽƊ8gG)ik8:!AS?Q~+66K> ez ڪ-dիHf[E%EH~e]O-ݣ=4S nvN=2@7]uS9 v%lU\mx@؏,&v%!Rs`Vt֟uJ} [\?t$@n)A^<̤n{GZ]}c;5wݻ)Bꮉ xa䡌"柡] TzZң̗rt IA[Z d~* ZԸ<~;.hy +=ߕ`OI:yF3}=e-?$">l~kUhOFQʉaWNiWF;CnUf_RMktIe~]0{6rU9ge 7vS D-gHM=XaI(>a6Vą]9%AX3~hxt\2J(Zeb[X^ lEcUب$ G]d\ Bek^BIF *GwЃ斃J֐yM K]!}M[O{\}K+w2~Ayay鶛-heMJĭW8;qDjC6 *ӆ]c{\$ÓiDpgu;a(Sx5k(ujV٭%Mc\|T-7v+VZښ\T+c+,;H%j=63sA1gPUиku=6@yR~NRe@Tʢ pW U~;ͭՎ3*Ժ]{ISv(y 8r%B^ Ov%a-&Zafu~ugò{$5 T; V3Y>%wjǁkOv*V߷ȭ)G]^ʰxdg JH@*(y V|ī q i"SҤIBcNm1-d %70N"&#µI$dJ[H I-&1|҂uFRI9Q;(lH$zj %'{O갮I%wV Ͳ =yRI$ɓ2bI$$ RI$:PJRI$E$JRI$d$$II)I$PRJRI$E$RI$ɔS$$IvN' )I$E !JRI$OBI$ƉRI$A$RI$$$$IʈNRI$I*MI I$fgD'(TI RRI$I"I$I$I"RJRI$S )I$t"I(I$!I$t$I$$)I$"G߁;srOGY$w ITf]$_~ 5iu_ϛIC7S5:fE%QtI2tIJI$$RKI I$$II$I$$RI$ :JRI$I% )I$I$%)$LLI$I$$I$I)I$I$JRI$I$I$I9JI$I$I$铧$I$EJI$I$BI$I$I$I$L:IJI$$IRI$I$I$I&I$N)RI$jIF)I$bSLBIJI$"%%)$HI9(I$@%I$nB~ɸ !I$u0:)4$J.7u"uQ<IE1JTyLRI%DBI(N4 AO)$N5N`SI) IrI%EI$xLR) I(O JRRI$$2JRI$LxPA I$y$HRI$>"|Jv=wmBћr#G;鏂 iL6voI[ǵeߝB?PV͖]!XvW+Rݖ R{qh'¬*5u"fJj1-(Vh$?R>ݧh2; mC{4rlQ;8ow]C/cd}< ,;$r"T~[V=1eM$[S NƒN!bz;-8a| h=4~)}kL❌0~*,"rPO>1:]ֻ8֬kq1ziGpN>=xst -/h [6'J4uG졆?=_ZeƇ0HЅ[+ wQp?ɳQ_'R-p{ZD4J6;ֈh>nz7ߚi$$Ԥe;FPI:Jy1M$&)Ro2?}߸bÙr^36V>$Cf;2֍I$lͧuswDr}]P{.*j6NW+Lټ^ӟmow"Hce ZвljRP$U>I66Cw& iNΙoUW I$m2<s\ IiЅ$ׄph.q5%R.%?JY#';G%ۏζ{M 礍un0[ R3'`U Ɖ%[mwj{GV2pr,Z]ۻ+6Yd3!̴'"ڎۇ$$5d%cXP1ۜd*6VXvAS݃cV@mooGI(D?jWG2l)Ysi;k>Oie @ #v\j@Z_g<73+ [C2M;;Y#_Wǹ+?CPuw4py wAhHrUPl2<9J+ƖOpJ&5c=Y^? (gf7:֙.< (_K^=juiCJ=U6`NA(;sG {a=B!wwyYTǏD 夤]-B-5֫P +8l{O;X9,ik6Z"GeYMhO(8h-#a;?r(@Bm+m>A}ē$[+8UsϥP2mm2`UڪeM `ZdΧR^8h/0;lzKUKI/:D<|V>\QA2 gvA4`0` eh<Ƹ_ .5qI WpxN0NH   O%@NwꫴtV۽NBeُl]%1Ӭmb=Ѯ8u4cmipӝ f74nfcl8va 7 [#䳃 k3<2[ۡ ߿cѯ*K| O 8[w~iV 6YZ_W='q$n-Ww4rJ.9A:ڬ{ @w u3C8 :ԧ1o߸IBlmh m7hw Ĩ݈׉n"N\kst.(Q3%-=ޫӛϴ)`ؤIlZe` o5 5zVi-޽ϢKAsUG\|ZqN%$.<+u,wҙW,ʋ-o[cCۺqo3,%~{<8,캽dV|C-2nh>+Nt< :,tTz "2VU{t-?C*'ŦAȹ5#Wc ŏ߯ް8q$^/n;~r wI'U׿of+`G !F[K,W6<?|BF-cc_%I)(ѭGF@Pq6;~z*#<-K'2m*=T\׺xhV9>${>Jp&/ma5UzSW:#ٔq]GUVu)+,۶}#ʥ |2NgcPZ}T4}F x(w)89KRȼR4ǀgԳW5>d1m4_:sI+Fd (jίSh8Nvv'HF+uTqw)'0es| gÇ-Vx\~gOu62egQC[/w0aۂkE>.i+f -ʟxǶX /5Eve*qf6#77mx(,.Uk5IIޠW6-K k~vTWRkvC?kw ?N-]ޖ|@JJB&g8)ctp%nxx\ko{VfENĴ!# 7Z S`̡lh/Yk<ب!Q'uud;|3z9]jJ_c_RK~)6\vv4,?Aݒ-PlyL+ .֔>Osė( gX<2>x{:˼V>=Xq7?1Xsrnjm7G")e[[R`T*qㆪ=O4H-+]'Fn.ӽs٥MTg#5iSRW&ϤT`#MEڸRP;ezV?˽p%K~Y}Jio$)+]ʱBN<k;ݐڴiu}x5*_F{=:_:Moߺ|F#_AmPi-IC]lTK Z Nlmb_i}c6`bq]U[Wu7hms)+@i) ۯٸ~Tءftw7w݆1׀25=0ՇҒOE[C+2bG_P*we9};v{ EdIqGUk\tC& ӏ4 J~ЙjI$Ѣ\$΅ I1TӢk0$IvLDA)I$G@VBI$H%I$ILI$B`xLI(RI$ RI$D$IJI$N) BI$M%)$NyH%I%)$OR%I$hS ǂJI$8NI10rI(D۫:BI(S($IqpdjT*RI$ > $&o(tBI%:ܥetPҟ EbH$|A!;̍ʂI$dU*EI&NS':&MZI4'I2JRI$)$%)$LI%)$I)I$I4h4$$Q)hNRBI$$$I BJRI$ dI#E/$JRI$I&I$)$$I$HIJI$)$$I2JRI$ M RoJRI$;&$$H%$$)$I$IJI$I2PI$$RI$E$RI$IJI$$2JRI$I$I'L$I^?QXU{IoEFcUa' LCݬ ;I$I/־ 9h_ϛIC7S5:fI*ˤI$$II%)$I$ )I$tI%)$I1I:JRI$$IJI$IIJI$$I'xR򏓖P q-%fb_C{oGi+Bz\{& ozHG]FYX ]Q.z^SwV~ &p>UZ߳jIeFC&:"8*<*u۴l~87mG-?Y6a^W6,F{],zv7x?˭D=Gk2ߘD5ѺvT_Il{TgaՎbV饔0WXOҳkH/?9jVf'xf\D()Y7$J.ߣ|S6KwD7xow&k2 >?V5qN?IHTDunaIk>idQg+4%N5HG^jżGMQkӹ 'Ϻtپy}g%M7=;)`Օ?60x4c"K ?dxߜ@S?Lf~uMhGa۰U21KN,rkM.ʉeC?bJN?el#SQGc),9fCi0U(f>XmM `A_џI+67$.ir\w8Su5+Xk *2[>Tk6H~E fC v i_jJY\ 2wH]95׏?EI)U=;x;BY=MD-w𧋓K6Gw!#jN0\>ImOkw$Mۙ?OEncj{՞^EϭޅY&aAYy+E[$?G{VD{x5jOoymce?EY!ֻD۫.Kv)Vv/\ ]k#Z$JhJE9PK)nQɡ8ջͰ$]ms# Kea6wALcVNEҬoMV7Rò=/{cs~}fX,~O+v{b:Ȗ:Uu0T\Ӽ7;lnu}q_Vu:rrOs^8+Ϋa<z6zÐ{bZyc-倛mAȤVud!e4?ZηZaTɲDZexՎ%MkR"P?o+qE\Gk g Or2&i֘h*۞y%[[4SEq*ȷ?5Unwv68ܝRQZ !ÃR/64= ߧ3Uٯ)κAޝ4@lgݐJۇE[vI:kX7'~(~Tl aXǴuI;/¶+S T =̯(mNҖʠX{;-xaF^3U6T7X/;gVzMmXJwL As{tl@ #1};>Q9PɠX7pPPcy sRޡ2+@NCned(2q c}.P g48x*94Xj<n'G#mFn|+2ث~ۅK+Qa6Y#岼pJlXn%O-=W>Ƃޡ^KAqo˭-~CPq:MI ٖFaGqJ\ԃ:'!t0 L jC5O,rA[/&1v%u%l.$Kju)mMBZ@^u.+vwT. q9}pf]#VP^ pGfo(V639NMګq[x85ӑ :+NOnvs_.=JS0Dv ֺU*WXm>|w(T*>_t`!b[;\z+=Ռ^3} 0wIUԭM-@R% ^1yvXǬYOgT:5zik/%loWvF%][n:"ZG(G PmkSZޛ1n=7n~IOgPn䒉:#V41%xS}{=Gp8*.<Ļ̂Nʄ Wyh׊ B ӓ~+\ =:;ll)]fD";C;)Hl)۠uQɰKw5YƇJecb s8byVA8UrErm䓹 k=Z=N^1ŵ|HpcHI@q BXУ`úHX<`=!$osꨓVCAzP6-'C¯5Gna:2qsqIK]hQWdZHi:z%8%[q{hARiLe0J4Oo(\nWi~)S%,J,G Y]eCn"WE};q,E" k<𒫻=;T칵qB.61nwMu{k.Ucx^j~Ouؘ56t$-F *l6A'+h{KP$K]=k npV}ܶPem)Zk>8pV#՟L]Dn֒cFi[yC m3%3P~C" .撆wH@!T'ǴދxOroK+nOFnvʽ*i;v(u b[sVmÈwyp*s2Z3GeO圐 VUB6մ,h>}@lXudߠ:a<4rP1 djԐSVw_DYNJg}Bڨ8Py{ ;ȫe}(EU=]jdd\?N^8h ۊUmcW#~#_C2!WTu~lՃf\iuPN+D?RޟeǶƇ4wb J>ik;" LN8u졅hPf078N#x+Wgf~%I/0SY粓 *x?K|4}/NO5Wѹ/ۏZH͓lWws1Y﫞B䢀1:nCi0;a]D ma+5_O O$xO##S(%iСb7$lI`.i VvZ?8٥/.U6VVji਴Á>!N}?i+*7V~DLM ITr5džJVgEU.}[NO',IK\ La׿tgk.6FaÜxg ]}ڻ;_5rCw`*̥_}jH]mjx)nI,6nLQ-fԌn0?;?&F n?EeqKREn̏Ȓ|#NmTke;--糿Hv1՝,_,pkyieob p;lopP%ގG;LILר2MKo<\kOm07׫4*w^1ȯikjh"rKC+ВDy'Ē }oI&P7X%ݛB{s% W_ 9E.ph.qS0vWXFq7ӫPto> N)q;,h^3`yR(ݟ?u^HrJKUGg{>(KqG[5BE滐X DZyC!w5ݟcezNvd7cG%,ܗγ?RGW?uF}8su5Zsx$*_;D S{p#g%J̇^N?o̒RvxJqe`6]MzvK5'n A}'IDݬdez0ƍ;IUtRwrʰ98FiRR\㵃`w;J ϫqῚН-p.O&v+Wa/XW*GFr{'e@tcooPT}_ug`$uS!D#?2Z?  f gLhʜ2g>W9 IQ}c=RFY?4.ҡY˵$s~&ԩ6=ޘgX1eZ?64wV&sMW T.5cBN! KpX8?څԻW~kSۘl>74( 7bo[iIK3hߑGrmD4?5?2hOW{ *4^۹;qBw5޽Lr;<"{r:mwbkIT9G *434yCw<rp/?EF#|l?5)g'RZvJMMm=:gsʭvWJ6Cr[ig\h~k =Df^ʇ [Yõ!I=\P+tH`A%rJwzª*4Wfw~2YEz[sw0IJeQ?PZu]4Z8T[;\ TnaVJtISwU.oB 5oBVn6C/;f?h懶km'x dRꥮ4>)8='կ}!vpTh?:su{=\LǿwG;o>JjXlG%k2?O[j@)k9:iW1jA=\gPdN tD [`~s[k5|{6}D{v?hdz]¯}`6*]'S[]+|zkJ6WN&Ҝ2[Su9N*A`\{+SfmNO"U~r ѩQq&VoM7h)0} }[UP{ -fSSxX:nfEHGdnYյ˵G$4I쟅V3ϯcJmּJ.n[/wzSOf u# 9VI!]h@5UЇ~HA:wL~c:V9+W?3.=C37#Iq&N m#ϰUhq:qu*ޫה56h!cޑe`^JvuZwX ݩcP7xÚ %Vo \i Ϋ8jgYZW>:G<YE?Gn$ {]]3*tN= 8U[7Jݾ衺f!f*2Ϣ>Īc%9n(tZ2+'~ ;ĭ~H5, `<^Xwq `@W1Tv5֝u쫷3-,tgr,u]innΊ-` Ecz"14vBɻnTc0u I_lO#c'x'[ al<%mzUK4u+`|V5Ii{ē೪9n+1}ڴow([[1Ͻh9 NEKߓmoW*]boI^kCjs╙ nC:_i>%_mx];WU2:{kTĺi'_cdup6D2u>%ky0춍$L gcۈ IG]B8Q`e {ݭnB]R7*VH2Z{;BE>uApsN壉XI㐍_Y j!z0;?Us{Bq| ~U*4{I]Jz.>aGznu~GLp `g6Xc8mx1Q1ָ #NO!+'hu z*P:6.P/)x%`阢8PNx>䥕o9::k^跅O}ݍ>Ms߹VO l>YϲvД&->uP'u(R^V{KGۺNv]'T(dz%kVTQ[ZwZ'U?Y(Tݺi9Nk4gp\kflyPmGg7u`y bu>4̷E~R{  c:9Do)(w:X`dJ11tL4xh%7@i%K[~v䅍?K4G$smFykcAY6+k0ݑg%% Jؕ QݠW$*ozf=n- <q_ Gbqcmjv3v%% t_!̴KdpB6G!8r]s>t,CP?hò\pD~a~5f"RT>ig;QOwc;RDd}!%߾*)Ys_e !<4ILcmv0Q-j b;.c1֤lEp9vr*f`kGa%G"msjr~*kp-IVdiX{t7gXmF \TPK5;[n'|lGSI5qzrjn[iX#t{]17f5 C*֒Jy*7䶯hǀ[yq)QڽWxRF^UZ{O X䝵֧Q. 'Rׯ;Կ݈pB-.0S iE>+#c+ZK2};~u#GjAk^mAU֙S}VNY ;:aS:EgPꇉZ}paD5K%T*%*k'ҩu:ojc*i5B}=pQl``o2^ Df]'mmtzjǨ']MAGg02dPOW*k?A0F$9ݖ3=fT{2bZH¹?e\LU{ݣWzF-wܬuo:+e٫aYYcvUpǣs+FaHn B-RI$*E7 . N:bR)10)$H I tRI%8ktBI$H*'(`TI1)RI$'LJI$E4Jx%)$HBD$$Iܧ)BI$$$$JA$a)I"Rjb $JDN"$IH!JI$& %I$tLtHI'& 'ħqTI4SI4O $$I)\@DI$cLӪrS4ARI$A):(rgOʡ H%X)JjdQly$Ot'\#>vOt' I%I&RI$LI%)$NNRRI$I$$IJd$I"I$$I(IJI$51 BJRI$쟄ݒRI$NuQO )I$d$I$I$$LsdI$PJRI$pS$I%):I)I$IڙI$)$D`'opI!RI$INI I$%:dI"I$$I'LJRI$$$$I'LI$I$I8R*!9))I$"H>*78ʭ?b`GgpI$I%QtI~ 9h_ϛIC7S5:fN3.I&I$E2JRI$E$𒔒I&JRI%)$I(I$I(I:dI:dJRI$N:JRI$:I$$IJI$I'M)$RRI$I$I(I(JRI$I$I9I.V]:ϙ)щJ3N>PR%CT̕c$JRVFUrVdkDLgtv !@I:!x#t$LRI$I$2tI)K(I*I$M BJRI$IBD ITI j򒔒I'8LCDI.RB`I9OW::,!cZp1F-rd݌̆H?ݣkx'}B7w7& YQ̩=0?97Uc`9 o #s׿SKN9G+Oإo:[Iþr֋u̡ 4 Ҧ|*#7KZ}=%#ֈgZ\C[R #Cw"3}C;V8 $%k5sT$T~3؝u}WRIKDCm'!(Xu7s9&(P˪qxՠ{soav};{;gT\2O&]$vV;R Vmxg_\TUMm J6NS1.ԟˊy.pDEDZ=Cĕl<04Jϯ{f̔ٱ?7}YԊMpp S6Z6WsܠB %Uns]igvk%iF[SK0))\Gn{ &n)#M>O jr\$g5!?0IarⒺ3QPx*X"S67Ж=۬ jYP4CGT!8w翳?"'@Ǧh'mU%5;ԣ2~yGYjʗ75oflO.?FI$iDФCT`Oov.uW􈪱pZKj=̵xGdTS7XA;PiuN.yJ7ng#XljWPۛ#UΩލwgI)=5iսv7KE֧op,v٭'~^~S(n<˿k~+ -qkd䢄Ń(nfGXAcHp0BkZa_{\;p08U/ViIGezt|ܪ+[°]]E%M?D(aG517k))X nw*Og x69֝B!=v59A㺧zs{;3P{Mso֬{mh{ iB=7 ]滻QNE4 *un-p&[k$N;j=GgYV]ٿGKEm&m):.4E=+uagG>Nnzu MFo;TLlZ O%Sw +ͅ8ۆOfGeCk*:.PkK։*ۣ~돧XOaT_ѡeQ"i\έun:5.f4w?RՄdYte α/M(2!ڸ{棲;9Gûe;w}RƸ90p©m,iCgqDN f}k>"u>rDvjJ0ȸ%4{+WJkʇN!k u^=kgu;3]١4S)I^Wd;S~(Rچ)mb]*xv;mb|Jf&/Kn<2:*okm~#AYckV6ٓZ7IuqhέnGxI/0%j{hnxy>(*cqQm[ n6-}FՔ74(wuNhW/P&N $,2ƾƆGu,jrvcV!fTY-egȳ1k ?H:0):+#,;k|e)^CVK^CG$ t̐iE[dZ4 odfSjI(94CIʡ̱7hbY5YO'7L8B7O0tIYXsdrYŎ-f34P؃LpyTNGZw0eT`񂧇i BM~dw0;cUzSV:wx$/)bپ{&KX~!d];)%Sw9ąߦc?ulS*ؚVI_{ %R§ֹWD(ij_muRV;ݵ a) 0r[zF͘ p:m-&BȽ׼IA;7l64iOs-㺴ֆSv=2IźF$hJ119HxT2\{)l{.BO;0_ض *"nk܇Ye43;R6U%+c;r~J,swAJ a㏹GcvME T;{Zϖt}HQ╷3SE%x+%3(Qߏ& ݽ@p2.?*X=6ø*/Mk[ %C3>6W-]nޭv^ڇ,]c{Vϧ(wrs|slx/;洰%!ވߤ⒨ !?%;[wA ' ^육F78ޫcK]ETdWa엚|V=ӜfD<7cly`{\OTaŝݯiOMb-r}]_ p|RVlYc>b NhxUֿȝӱ^Őمt+wO_kiuz}jq#Z>J mo( ?fv}Q7.{;Ŭߜ$(k~ء;~bQ4 Yim>Ee{~uR__!NSga.O%7Ta.f~{AEoa!*L%wndF,s#4%rnm2LmƯ跔~quqJެ缝-UPKkm.=0:\o[OXm!(x^6Uxd,oI l\$̊TƙC^Sy Ҭ>&M]?jٓŇ7V c;.CwVesUV-O%Ym9XKeuj<*IR@:f8,uOh:[O@<Ҳ+*n&)YeX3b[==o: I@ײO k'_ t<3͕x!OJn2jxq;Z+ÐӨ%o: 6xHH3Fw>*vc>[0=,+t0hWK*oYG'-mx|6k)lpCҡPsApϏd}`AЯˮal E!{d+c[k?TnCnnaء41m%Gp48\#dKpj--3j¾ep:9%uA.a$[C\-x F 67nطB+nN*!'Wp}]?ٝK7n'jIf^x$, p~ݜ$h$::I,ȩ![:YGfwW@@$ؓ:D(?W HCusO~4Z+CGYle~<r5Oކ/?ofZjXqRAE9sGĩx怠Fx:l6XK 0<|[#?M̦lyݿApy췸]O16Z>?I>h^YNYzvX%5PkɳœZtmU+m,xP{ҵ'v9:gI%lնѺ{")Zw Fd񥟁Z{kis4rJY+J"ZD J.q';7?1` `@s6T7ٴccٕfY5bhѣ;qkX?0OG.<($=kdGvٿ%<ff2mO-Dxc, *5œZ~bI j 'FWkZ7աTw :mea%߰8]G.:ʭ%lh,;s*1*' , f Z׎ DkUQh?jx7G%% cc"6UwxU,B yWh.!R{$HN,2>@<!X wQ;T 4h74IKa*5mY2[gs$'] X/k v#VZ BF;2{ NNwlZJUZb L=vZ=J髱n &Qsq 8;?{I[/#+\> ;`SOp14C[;g1q {\˓UUuGVgQC7XS^FR~{@5{MM%O#%qѭP-B%~+x;w~Ei-o%1\}Vq^ÇX⓿6xQ̆gARN(Ӷ!Fgigq!4pBIaeN]#7O]J[ꍴP6J[hgWYfߢ̪vUe@;$/}[FjPh/!≌ ;#Z 'PIwv%1u gG7=m?K?PCu<5?[;vS4F)do䁵ݝe^hjP C,v uguLc.Lpf%L6ţ7cil]Vi4=ANǵ9ARiqȦ$EUq]}z m);\ #W`z6V7hVkQm:W}#J]mВ@Q[h˹?E5"juU{͎'BvcebUe.~Iآ{;pD*vRALԮhoV r=SFkd9_I^jw*7d6ʋ2^é;CV<$LSc$.Ss~Fq[^rm5e [0)/eɯ0YZO'5΍j+)u\vՄ,>1ǯn]V 0#^Eeph.wՏvvұ$bߺcͮm!l<z:FSf?5I-2k MXձC@'KPQ跪FXpuZWskf? m5qj8\}I-GC=2"XF#Ae'j#X,- cJ߰ Y' ,!cBg鿺 }:’UlGCuH}Dyr,oVCqZ̜m"GmqXU"AςolOrqF{UqVWQtwfp_&v~VO3*gN{*H!S>%+n˰Ou1X]&u>_?NA7)#:m-'ktR # s >tna٪Mɧ(oin&˸ǂJY4.H>ok<[}C?3 HQ5$+YxuSxr01c~i$zWMK[4=vV5qV:R~͏cBBJ,i5O<n<+x PAAg(уBhdz!*M, V8_ܢ*ǣg9]…>"d;7bӇn|ۈNfm'{c|nq⵺ np-n؏ 2Z7HJDS쬴*ٶnI!EbʳSLIo2na[uC\ʍX›6ɰi!!F7LKѾ) ܁ :͒c#Qؙ\6VV%i{er\/IkahBuޜwYovfyqZ}1㾋Hi~YMuf,^sɪI_`T;/sA Lُ֒wcqj4U2:u!6.un1VNsc=ω$OS{_#D]Wk^=;m%7 Хn^ v(Ϳ3m.;ƣٝAifKc`~ 'CV;,(^ۆ(X{C(67c Y|{9o7 {8pl U"yVp 1$ҾTw*m{2G<c, uCpI;^;[:f3KOsRʘ³h![)ϱ\2+e8~IE.5I|M ~k,7)n}!A?kmQM}c!XUceoív=Bzt{?zg;pӪql*]vUmVU$j_;i^ R7RNR|JEk&=-,;TPk;,eoy'?g[[? !_.ַiI{Z,?G:o f]+<[vKa5CtַpUQv-MRWeH߲l[KMЧTAC+-C.E;՗Y5XݮFõy-.дÑ:?cGFYc`V*Zf h~Hym4"tW>}\jm,'m|POV8z3o!53OoMʙ9ZX,]DOxjR{Ʌ[Hu.KVOzJ]'W~u*Z%5.GNuO cPNE!aS *7 ԫ#Z-s]DM̵΋O>ZB̶@I5EѰ55Y,{A$Je?үJU +1hWpJʺKn-{_u.9N?S5[XrJۑ_[gD^P& vAsOU>.}&sh{EX'ޫ2QֆIlM,Ρ={ 4f"X-8::ԭCyqhtPlkW3(59^FxxN=Be< c&EkZ?B`@N`D$@#T8RGpI3Β 3#u):d)BSBDbI&$ $IxTy:J]TI" <%)$L B jI$ $I$ RI$ $$I&IJI$I$RI$)JMKJRI$9MJRI$Nx0IJI$(!I$=8HJI$I7EJI$ӺuSPRI$d4%0JpdI IrvPRI$NK$I -;LUyGBI$lcuQl8ʘH$S7:YPsZvq:2I$V}АEI$(GL!m)$@M %RI$"Me1i$H`FkM$$B.e1jHRI$OjA)I$LX$HG"mN+I ;)!I$ –P*RI$D)-EJI$i($J'1\I(B~m*I(u NI!hLT$$IFAB}(I$pt6<Ӏ 8 RI$D-2x&0IA(9cI%5ND <=RI0=)RI&ANOGI1>s3A$)$QӇKBS($LL R$$I)4|*RI$t-ȳq?ht-ȳq?ZrGgpI$I%QtI~ 5iu_ϛIC7S5:f QtI$铄I2t$I$I%)$I$IJI$I2I%I$I$$)$L(I%)$I)I$I$I%)$I:I$$IBdRI$dRI$NJRI$$M~|J!!I$kU=3І~ 1ؼH(eH()O(t铅7RqC%0IIDSJiRI$AHɏ)ZFI$H$I I$y $I'𒔒I&9'jI$wN%)$RLI$pvIJI$LJRI$82tRI A.)I$@]JI%!“J:'hH!I$N:NyM8$IRQLIRI$RP$I$<$$ITZI' !*I$A(DI$`$I&%HRRI$)~)I$IE$I.Bzegb2t{4ȅ ZcK8I~pK;&O-=Z,p8g]M&zukPw.V+eM#1k욿dMefAvA}αۉ~ gd kinT 8|?98[r_7<7FVv4aA"kR" <uh.Ux *Mnf⒖{.2JA I+>V2=E*C9b ]Ts2F@8ԴX?E(Uƽ9ow_Uey;/5>hʙVNCmd{?gzz"=ve-.<#}QOe?5%;2Fvp;9VP]ӱT[gP;);iwkPP=:g~!do x'ߺ&OVT}I;lDzE_^Uie CB>c֫. eo& $8v8$4蕖8uܪxmȇ}\9GUlMšFnU(oJ5][睬HMYM(1şD8_5sI;w.CKw$UG6_g!gu h;gd~=/aըiӴP9NEr~D%޾<2k)v}. >ί<Em>j3-s?[khc4p~T 4IT4.z0$$OG+jTjxc>0PeM iO[v*d;Ѡn͎i'\]TYgU[rHu7V1`\9m@*=,7K47,o4>hW]?hɬ}A9TjNUD1;i;}5Jz UpjkU[*heb9g@U.M@>RFZ'lT^\%0qi 3*jm[`)=v$Koլ ZwܸTLlvc+u.+(v;?{IL*hdߤh96<#kGB]sFx"2]VjFs/n?dHmrIB!Y[v9XOވ絵E;m/-}J;ֻgoU%0V1\_58K'P|9*VN/qF~굕C.a;Pjlz,o9W>/{#&GWwxcwLAs]Edo.%By_cǭ P44@w̆lxӴ~oiQ/%lیYPpG*R\dJVDm\~suO;;6߀JVΛ)4lhJؿ3gwĦX12I*6TۚX-+0Q8@~?:eIƎ+VX6x$kYW ziD~cq}^xoMֿw>2zmI*WXzcs$3?k2~?4̟6+j{qײZq% 7I7, Lpyp Z';w~ʨ݄K֣bǶƇ)$3Fַdve 1`?rcB; S&߃UCe%Àr2yRR[PIRuk;3*}VmgG7UXwPJww.h,XDؒ?$wڿDɤ0[Hjn85ө2WwWG[ f;+xbپN9Ƨvc^_IJ 8zwǻT+qIyhT1={d6Ko1vy<*9w[x"6I[ Ԗ%K;,#v|uL<;>+-k`#~ ˏQ<FKhxh%0wwĢpk};5aT'IDgJs]gB7i?7}g/x#Ӗ"e@բ6Nyp 5ڇvFtS0zLo>?Aӂs);p5*GӠ7"ѥG~s?E{~wfmoN'QSe-\~Sk kv 3֛ݪU6`MVaW~LI(ֻsDѝ7wGggX"]C/n|pM›滳5h۬;R*uNߘDV?9ګQcVhR假+8oNt<okE;PGKl/Z.-z0ocswc|sY%} @vU$TUGXʉgW~ТTȯ%)ē纱N8h.ўʶ}zѠV}>͚C*8Өc߈ALro{X8 yDsVrfO!9;.?uYk9AETؤO1%3e_pyBuZܘunw7 ߣly;;G'X{%WNGcQ_1^x 6.ՇMN\QC\u1{yosEQfi/ٟ4kD3 WO):cʵww(YvYOwwwPcn{\-+Q@*6L]R~K69C8*.q:Ui*XElsm,$(ߎ;ǸB!8U迱Icu}z Vw0RTe0k}J{riVaKB ZxFc\oMS}4S[qcc4pEJjqkEǁ rxwW+U7O6R8ߤwV:s}}''*۬4e!։%duƂ>Ѭy;y5Ǫ1>5XXXVerHQI{A@]uUm~tÉZ?H~ rb\M/ºĕGKմgۏY ~K<ϒ[] UK7H5&];+-hhK3 pN͇kDt2}i^67=Q:چ+r_@5ۓEN- [MpټC;[&By4'o X?7;KfLV;*ФhQ[H#S_fdÅ#ٗiU:~-MR;;nAҥEڹOX.(M۬7$:mga E@hPՁMUO6#~k?/kӵDEUt9T.kEڪu{\;Vٴ1S_W8)c0P>5ͱ#@!ou2а |uV\?c5mnu2N'a-c C|L &.zQVwٺd]aV[wET V^5'";R #Ɏ ү7==#mt\W[g-(0r}-bb]Sl] Fed4;^ I <˽@LV ly*έyM G[m[#'݄*bFE`;B)1w>T@r#{l!)kLjAu=՘<)וGSgP`w[euQ]u4}#W}kv>V=MBY{p#ϲ*>wPsy &soyrq0VYU;kFJ']>Cvsy[l:3OݕN8NzyvuJγW6#Uw[5(߇C_@q;ήDĚַ.I&NpO~~ 8ƝYf{#)=ٗ*l3+x[HSy>(VxIT=6}"mx~% 5Rh gG?97 btYMcsvWTvO{x&vV%ߑ"]w3ǹR–oV6J{[VX5֝~U֪!%Wuw8˔ l`)x*lS[u"iLcZ[۟I5`rjz ;t\KtGƖM:tЫLpyY}Jl5F֦6 BcCKl6Cw#v%.31e7qaj h5W:v{3q8YYNôڴRQh\Cbu%/xS>}+-nz3nk-o5HYZя%Jܭ -5$:f;~@UKE0+N0'WaVkn;t/X- 10p'RW,-A#AiȞUV,nmO~8*m浔lgT32 \Kө}״WIZ=WvYIWaIp=m}cHk\]5s#o\q:vX:u%)d֝XO`xV 1bh6 1㹾y(cP?|_FSS *>U5 w%y}sL?a}Nԯ|# ՝qبQkW5/|} ~}giMC݁]rX5- 4I_3Iܷ0cӵBVZ[mTZ}^-o1m~:u@$ੋ#'Mp8| 'Cor9y o5g9Nnѩ+ v~"- \{(}Mn~h=k(=}~T^_S }z}|ROeQkw;U >_Hwn<lO^y*9|S2tg.Ls f]=}ĤP*99MxC#.P5P}KN993ѤO(X]P8V4MelukA$LN,k 'R{/wi v8sa;:N+T݅t~SfCxxflkSX!$OEɮ|t!IU͘vQ!6hPI[نOv9q-BWoJΟeoC~cJw˹+5*u[jTr7;胢{\x Ԋ+ ,ƊDEX?rYne{ßU 'uQ;+X'1ooY]V`ke>Zv (SA|` Sܢ'Jz@x!:櫹iskH-աUFvDL?( uN{ζeA0AafΩς6FM<{ D PIg*iNxMH .I&)JQ& !I')LRI$(ѝ jI')4)@EJI$:JRI$E I&I$EJI$H&)I$pA$I"R $RI$JtQ )$H'N RI$j)BI$pԊI(iS)))$HL I&K8QB;()$N̄w 4@I$`tDJrw 4=Is z6XU$>Ue3P:hޣY|Rp{a]$Jn!@yIS!d铨&tg Q! !I$w&: %J RI$(ܘJbBI$S4Pܛz RI$@GDۥ1!)$SRI<qBp9*I$ܘ&.$JI죹00I)'({/AJI$pI$ t-ЂI"{$&6"RI$ |&AVIJ@ ؛IVI^)o)*ԒI"&ZI$x$jɫz$P$JNI$#o SRI$P .R$"$H.s $Hb3I)I$k(IjI$D% ($S/H>R%)$RJB¢^I)I$LȨ_㿬*?7"ܿܐk&w AA$UI$~ 5iu_ϛIC7S5:fITf]$I I)I$IdRI$I&IJI$S$I$$I'I2tI$'I2p:JRI$RI)I$E I%)$NdRI$NJRI$$$I:Ҩa*UCGuRC2J#t{1()НAPT܄ₗ$t79@'C()$LT Q)JI$TbHRI$9Mʂb RI$x$&%I$pCI&:&I9NKI.&1)IJI$'jJRI$ΊEFtIJI$eB%)$I8)W)$I$I!I$@80)%I$p`)4 MA I$I"5N㪉8$ITSTI1M)A I$IK%)$Nwh)8I;uHi"Q RI$E82%JI$ i$ s -[I4칕P]"@ae+}-uvgUGHIX?;ʼnhk+dG~k #pTݘi~jBXIq?Xuk@3Ζ.;(oRywrYmljiULMwlGRMb\(ZwGtfUM*u#{gیPk7W/&.,;w.?u8J6ՠSYi0p:qKίW4YYRTl~3}u~Ve,y%AHEmwV#r!쵿E~6Y.rۇZ..K2AM?@$JJaU>!5=J?{TnwbҀ&c :Jnʃ U;pogR ٿ$,us^J&OtZgo)6lnE_#oa+z?Ǵ uM_جk,h{>j9igIKWs\Jߣڐp$@~w][vh>CX~TL|oH,;<1JَQMq.Ԟ9%g=_HXw64EcQZ=T@9%Nˀ:3vKլUX"\kjO,k}̕waUߛSkwqFg޶FgfܫJՖ6h"9'ېַҧFw=';&A&|Zv3W!䪁[Gw ݝڮh4$$hNalw58;;3G^:pGpujkj Yݿ$\=m!= nnrJ}A՛FV%4]kMאckL8]s{+-mM/y1HcG?E;;7VVY[pc5%[e7Ix!sjoA\q\}F@\?~kjm,xTon@hGpBz9?5 M}a[=v:uNêzou TA2ã_|[&{H<;"p$~Jdې pM1U/< c$VuϤÑr2=#IQX}[NO~5c6cWSR:h]JӫXPdth-5Fc$=Y{!'ИG0jʱZ-k4E[cv %hKg\u~`5ƵZYv!ugoSnv.{1V5, VC^@[[${mUABjmiTYNQʝM 3NϨWL Ԕ+udS}3.n@ߡE -a'aSw< kL[OaבnGɾVRu `! ]& XQV}L}彜!8Sݔf~}aE^MӿQ›0 L~wQ1wr۷h;(m-7b8b-'wdz:2SmR^ݏ;xIL+;+o>%B[ԫV~-PwV{Ukv柗t5w2ըI,UqIU:G$%g\^7CUzӏvUgtI^Z}K_ck|J1;w20;[gQ]%iJ+op_/>Y;Ƽvׯ'Ģ9hT~(9JYEq-hpWYajի~)+Ck3SS@}&Dٌ|Xn}.A 1F]=a%6m8"BmFog W6-*n 0N%kݏ`7Ui聆r_[I$0cd)=uQv+ ZU<cqif~|7XX,O?cF 7֞ȸc:VKnG* i*Fm=zQS3J;Z6k|.M\x cQ7_yUa{Q,ұtΕ~mC]{u.CXRWgUB _^x Q^~[H>6Xq%̧mO[]*6ApldƌrOn<+*/x` .@*1]U\NӸW=g% (%%55ּWi+eeZG+wĹ٘/kqs!]h:ÂHnBcEW4Vjxúpn+$mte\xu´"eV|X-J/?cGluG:_eVq,x=7h5(o'ֻc~4ICAmShV.ar-{'UTfyܷ-[ s/` uPhHZM E3l&sŽ-;}"vm=͹C2Zq65/ƶ?r׵{Y OrEexP>e bۡON5ƚ]3+#Gqw[Wḥ%o,}6oxhG~\v(.}zA=DՎJ#Uxn"uMЫ;sj)Ķ"JI,(3Gv8DnK^O  TiV@ Yç3USQȳ$8rELV?S3˝v[{JxWB_^Ҷ񯯫]hSo ~+&ʮp:UG{>x)C uXkkdj ىfhXO \Fr:2/gtwfv +o"CĎ X-5ڏBq]E"Qr5?Dӿa/fU{J7P892ߢN^ڊ:y+)Hj(g˿:ôԡtLAu 4[fDV41AzRʰߤcaWUoW8C0^KulBǪOd]I;_-K?*N%BL ^W聭X7Z\lyT̫7sj[E$=| qG'5/1@5jW Rk2c][2WT,/sN2qێa$-?fkPD%iUh p=4 S=tBqq ;kmWx%'hM&a4VU\=7Au:MGaa*Q6쬽hVoF.|:$rMC %TlO~ PcaúXt4[9۞XOR3Xp,qK=VZxkHSh*hЬoj1ʮqv3{,èq)T3i(vg P$!K;m @ >ێwnGvg69bA6;%j<V;*ng (r$ 2ٟ%_Kix D!j@NS(NUl!Cn> >€{vrPkSX>1UpX[M+UNYc{Tsi'%${˨~$k+w(Oy5ܦmy`y{8"4}x3E";aՆc AIKV=Oѯ򦹇ug&>#ZwIn;ka#YYVu gTgaaսnoHaqkG;$C<;st7m\CgOVCkh!\1V0ݫc-kw WUqѡwS =i9[VXSNXof؟7_SK;\}эMsiX[=ONض 堔6Xht"725Sw#{; CLJWCoLG}wCGM ?JUm{N6_v(#clI=4f1ߦp#?vvҭp-?=?;5(hs0I;1~|ZV?vGh? F=$8dcOFoV捼%j5<,-`1[w?OkV5%H ;hn紆?A^Uo!;:?ոZ?:54J"uma{Q̓}&tHSR(O! ĔX#PhR)8wHI$gAwKPJI$)I(E I$S%)$H JRI$$RI$I%)$N5HԊJRI$p%)$ND%)$H7%9RI%&!!<&()$RjF{&LN)$Q"S:H)$QtN>6$I8h=Q")I$CA%3|ԁܑJI%&~- I$q/KX椏ʸlIFtN=T2<͏5tdI;wO(;;̶8@BI!LtQ…$I)'ZI$)&AJI$: RI$I'I I$$:JRI$I$ҒI$ɥ%)$O)$IJI$!2rSI2p? )I$AH JJRI$)OʉIJI$LHRI$N')%I$I`))I$tRIXnAtLJJ$Hg$1))I$ bRIJI$1 STI$$RI$2} I$I$)$IKI"LJS⒔I)!(M:B[BI%{Ho*8ʯ9 Ȩ_㿬*/$?:A'pPI$FeI%־ 9h_ϛIC7S5:f)*ˤIA2I)I$tI%)$I2t)I$I RRI%$RI$I%)$LRHIJI$$RI$'LI'I$RI$I$I:A2A%)$I$I*I$iTgYVT:K]z[iȞU䵆4IW\e@ Y)S֩$Q*ORI(SwM*RI$S1$J%2 %2BऒI8LR%$It TI&KrS"$I)RI$  I'I'jJRI$NJRI$)dByIJI$$RRI$KA$I CDI$H0Nv(RI$ Q<;$I'L$J%2tI$J])I$AII!%)$RiH RI$)$H)$I.JqyAJI%87$FT8{u9t:jg=3 -410<(U*^hɽj`ӌEǾ;vb0эpKk͍.{Z \.lUoǘ @ 4>H{*>$AqqVԷqs ~cv=4Lr )8#]jnv>:n d9"t΍g>jA&&O*ŞvA>gOu9'˄u9IBrÛOؓ[Ly,v䬵7s%(R{a3Z^` *N{ZGqtuA&7pջ;J'QYv|Or<3"=Rv.2⣱s;(>Xer3ֵHV+! 0<C+1΂^<+ս49AǤIi^TKF|\6p]MMM~էU7c4v yXxpUfejl҉+f`>=LpqJ v-LF=ڤ+=ӶZ;H<(O %>:&/UL(mCm-25>?jWXq᣷b6ckO~I Tk{gPh6ag۸lg{Gp?my'.lnvmhYO͵bKçl'Ĕtge? v'$JZ\vjZ*5ԞpL{*w7eWOµS{2YT2vEÖB ;!9a=v:#FIR-K h *CZ5I?i?q\_wIcG(z7b P}}o<D;)Te@dhSQQ [.\ccCe$|X`Yʻi*HY,lW9%G'+" ;)MgԴ|?UNw'U㶱W_l`XxYXG݇ yX4Ty~2Y׋_[q;ޒ Ge;eJ\IV1 ?\ҥlo {[wM T:v^f;Qqimvm,xAI^Mqvr܉}BS-4zYN亃]:s)%I+7+Vh~U}A *i<}'o?K*ZhIJFeMo7Ydۜdtv47`1(4R[y#dҤnXMmv58Ѯw8qA̛UN?4*~eXiifΞ78?z&>O-pc~ON{w; at9m+rέm>Xx*6TꝵB:J6Im1َLu;F6k>+lm-/yQ;5܁uP/;7VIL⊖c]cX%cʌ'S> TNA9gaP;3:v98Um~UN,׻GE9ǵ?Hѳkhse wն+*me]Lzyu[*"FA8H=?vݎ~Is~ᥠj;9V24#}2y)I8Hk\z4jSY4'::G5TVwr|Ѩn?GN6 =ţl|fO%>FChl\xy߹ѭ(w댝8 4L7@9'Պ={qR|' 0!oȪsGf FkCd~DRõ&-h`pB#E11O*61ո >Cr0ywzgqt^č4 ^]C;AJYjԺVr`)wov)V5ﭶ  gw5&Ŷsi>ۚ\mp3)!f;_/x!c+}<+jZ+XsIVUS:*]쭧VsP_nG;jU5=-s݂Dr[Xo hY`mh 7f%֨}֗;v /62VgPI*rmvy,?ylnsg̯>vAyGuVp6 a %t|6I3V3G<{3[q2<ʳuPKj7ɰ4xJrXQa.CGqQkZT0J'Q[Xx, psZ {{*br[$c9;GE0{ͥ )c9jlŢE5D̼%aR5ѻ"S,BYgjkp+o!Wc;`G\mܖgK$׉nȝ ]͝0}ZZ4M{E9#9qA=!džE +}ֳS(8~Dp BWndQs߽hKBPx}7Õ_ u nsOICM:'sCRN#T}p-9YbG/got7{:w8;dUD5i!GDlYE a†GH$% N?UQsr&F~hzJWH ̵K?ima} ƟZnԟ7z5Wci$qtT_m Cos=i~ǚUm xBM透dknX i>a(w +V=eֳ<%eq_=ς+f8ruGeN+O>}xx3 v xfdhВWǒנԨFh*V%e؆ϙmlLq,:x%JaP>JN2"B\mxJ`!YS; {u3ֳ-nwՍn4QFڅ#PG4Є,f[h.Ӄh@YXky_=O>ӽUNN8יA=>=8rίHnUZ5, Y*г@' ~)ød|QT84s7 fTHMևgU#xpOڰpf[䒺th0zvYV5R7]ݓHf*=EwB((8b*ē;mn>In<Wh<c`hN+K)$tzCo]GF$4I@YM*o'|[7,J} f%&]<Eu}K5+&4;'հVU]у=Lu2eOJ伽\xZx=0zz4jltqXW^ܢNʄ7AŷsDVDkV1ĴH*Y/?)[m$6_2ƀADm#SN.ӹ=9aƿ31XǺƷLXm۷;{Cڊ4,w'K`!7䁇n"NVA03?qVShGem C-Dm|̆?ITr}.]g3]u{qǧhf>h1]RPZ=o|ڧf3_;(ץGUƻZ,n<ڙjU7B1?A՝5w`aGI%~LQ4wOYüB`g M?l?j-ꊛ35azq/X.F)ePiEϖÏOa ]Sz$#c7eCT{k8))+t75,2׳]'9Tzpm8-@Fk1Khv]keUoۜø)(UZ{>F.: (ox4} CtC>ceߚW'/.{y:xse=kĪ=;>ڭkIIFE}۝%0w﩯lFF?Hl}Yy9vY/{ԲMI:d[EH>)(Dw=J=u hq;UvbspkKi]?pa?2k X.I;l̦3A^8vNmβdǒV;--vUhxj_#cVVf ngH$/"LDPq{+ZD}cnEzڕ_Ov\}@#VU:Nvk<_mvU갷CȤϩ_\.l~*\XʗAo~;Vz{Pv%LjͥŸhRW[anwn6`P'G+$ B ugZߺa7ZzFPS[wGu^ |?ې@iQz+YoE.,N>JxV߀B1K<|Km?ɕ~τʇ.R95$LdV %^TCm.Zuu3\H<:LPʡCԒO@ҽο 5`CMն \{- ~|5݉F=9oEͶ*[S8}iޛ۵RVתQ58Ioe2}}_wF׸y}1ҨdE 8MG[Wp>*sr׈ B?U[.ni^KGr=79D/^%VδiZ.p~oD-`cU6Zcd0D8IsXQj[_Ep69r1{Q}ll<>Pf]GB s\~qpUpD飛 c{-#md Hd* OV5sZx?Ax SR {D :ՠ0 hT\tv8))yנḟZ`G1ƿ.تΣ#5J7bcM;iMɧk(tjXƸ{C}Cy7{pST]oS-<ʨ;Inֈ4cgc+]6NUn 8k'`1Y{]ze'2M:5r2g 脊I$RI%1AJI$<&R좊I&)'LRRI$ݒI$IIJ`%)$I A%)$R<(>)$NSIRI%0ST')$H TQ:JI$@)I)$LA)I.uQ%?b%)$N F(DI$b$&kH[̤ID#s3A>'ҘR jjxJFLCtI3cPy {|}*I2ušI$I$RI$d1%)$H2JRI$tH$$IRNI(SI)I$iO)dI:IJRI$JbRI$$&IJI$O)I!bI2IBI$IRI$tRI$RI%&L \((I$A I$I%)$N!$JRI$$2HRI$dRI$铥 )I$d )I$`2tI :dI_Ϸ"G} wVl11O#vH$ $ʺI$~ 5iu_ϛIC7S5:fҒtFeI$:I$$I&N$$I$$$I $$I$I%)$I$$$I$I'2pJRI$$IJI$I:JRI$$IJI$NI%)$H$$I$I)I$I" )I$#l!JáO 1RI$ҘBRIk*I'*%9)$J)J*I$S)$Q)‚BऒI $xMJI$20%)$LtID)%)$NH'I2I$I$(%)$R)&p$I$I$N*RI$#SgQRI%(7Q!;I(RQLRI%r$)$NA2JRI$JRI$$$JI$$u#ss)RI *e1G4Ѽb@øbvGޚ!~(-ѡ:Djݭ&cn1RGO۵=-nIriqǟ &洘'Pqsu&xљQ w(;F|^617cɩoIԑA, Sp9 mu-% 9ُc*T@sN*Isi˰}̗9ovQe3ه:R[{W&†?5"ɛ,@ w=;}sf6]Xf0ˏ)d3Iᣒ3GRþˏo6x;$ͿGAܕ3K6WvW#賳xπhIKHz qBV>%+K?ѱsӷG Ql?Pջӵ&Ԕ6[|luv!EN {w5ԲX$pqcG?Tγ^}ðɪ;׷&+)j^{dd3u<c3?g 2^c9$<"?5Fio/~w!dXZM-Z;~jnO-?Q6Ȯm'IJ}ͪYO=KOP!W|c 8n8#NKp'_uL jIGUΨxSl?6 I9op{sp~g[1jSK)`mbI&U5'C 4rmNT{;B׾8"q.džJӋՎ':{`7og?%x3sDpU&4Gk"+oC,mc*c:[٪Y:H?YU&-)g=:xMNZGBEJm)c7 Cp8r:r\z?OgjkjuGѣpƛI<;ii:Ҁ`}/)ִ#oyY$8 OR%s;#Zvgķ<@,eu?Ϟ"IUw=;aj՚Px= Vq}"|Oc.+&}_̏(x&m7~toQsYQunpn1?:xS>Ds CQ~w^L;hMvy|̽ / I%n4I:\Ok}֞OfC N~ţUt YRu2zlBNh HUC_x{7NǓfi ֻ{WjfnHps# S u8ŧոlJU֦tvrRU~*YJ65*IQc8@\jTIe%~XSU.=5W 5Zۚ QPa'"O妤GP:71%2TТcstU:2?WIwo>=6ka-FOP;O4@ ߍ*\2CPgJeemU79Y`q1xk h`LoP6à ޹׃ 2YY?RCj#=xWeyKno,HP~@~k?ELk:TwT2@~s<v'էۊ6PeTv;8J q28Wi[{qZJg{5V$NFs SihEҿ(z4kgsيW>Whe ϙk? !T6G%Ǵ{@{vsB=G[m8j NEv /P~{I+c]-|gVO[\ݎe[VNC/n?',A"efYUum}꤄aww)uN|vWXˎv+^џje ϙAúinڛ+1E$ceKYC\)b mň"XJ2x 9EÔ:\zY?=?sN VJ\jQ,oN;^b+VkjPkk[$lmྭݿX0SŇsL6$ ^T 8ܖ='./?5]I[[v Vf&YmiAUcCֈTw1NYa?sƹjO%).;V0ksJ8i3\{Xؙ-`-:ơQgmk/RJ,C3(pYrN1seO#h*;BU_rǨgmkąnvAJ~0ՠgqXK-@;1s +%-/?϶̼ךqwef_鰹Lk uFjJ!i^SqdkFXN57Xo">esCE밚pudg[:0pfP$#KI/# 饵 doc2)݅ s{B_T-p+=7te Z˞:EAੜZcPpcgFEv6q,5w}lGfmdSj:9ǽTGw7H(,ǐYUm$o2/h!b Nڙ͕}~턊"mcY Uu,uR#fH>+s.$~zœHZW|(hu_;U]=F4QݐѨ<7TI!X䣐%hu2&%`g# pp1NU`㒐QԠn=+i8p>͖cCVAqw%"63 z_ǒ+kD[*<,jqiq?[_Q;Ԥj l}^wOP:cp pwk?tU^j޵V괵~%lt!mI@މ1= ?T0<+^c|Jvbc/MũcsKb+q.+gWݣRP6W-}4Dxcx#*v$5(3w*^w[JC}K}ѠYFK qvnrn6/N y \2{YܫRڄ4&}A![w*I('Ia] L>`I ݷk䕠- k nAЧ@u*`ZG y&vVYi=±gAiտDL|Lz} Va.vy+pç2 >Ǘ 'FY|j|x(W~Vp|-G哄rYe]ZHIU6(htp(_KwW=NJC\25<:n{*o2W:-ʨe?͑5ɱ m4=$5̪!旚iJ ŕpե,qGTu}zwzoXznP#RSK < IUи?_J#.8pNCBIe4xHU7/V9᣻;PHe7PE;LiJr9ڡX4QC߅[̌ƃ&V474JIJ;V%C86%^'Xlqw%lc13g*K-q,eN08 G(WEƠRd#TkM]44~qEX{[Ɇفd7\R螨wW5=hԂ ]?bG󿒶 amQpq@;Hr!.! -k%ðiI-%ZӬQ-8?(V ?w*UZ+q['+!MJ m8+P Gpmep`r?,MI :0MF4OeH4Hӓt7Ko_[^nUjYU)l!hl UU?IyznNrŢ*a|to5*&~q3[?=v;iR/p0tyOܩȯ Hpдjle ̏ӨTtõpG?tb9R/>I*cǿP#R`A`o{Gݳ:Ȭ uI>]L#Yѿ~m TEm>)gܳg_+k4>mHr Ww}D*G7Y:=͹&))I$b)RI$(IJI$& BI$ I)I$hd($JR)I8N$NE8 I%*R蟔I7tTIJI$Н ! $IO2"D$IF#C)$S!}3A̔JbIz9Rxς"5q>(UtI8>CʸG§$:QR*)I$ҝ1I)$NbRIJI$$PI'H$RRI%"S( $$J\&FRIIE92 )I$dRI$xMIJI$BE2JRI$$ҞRRI$dI)I$I% $$IvNvHhI'I)I$n<$$HPᢟeJIRI$I$$L$JRI$ TI'))I$d$$J)I$)$I$IJI$I$RI$LJRI$:?Ȩ_㿬*o*8ʭ?baΟGgpI$I%QtI~ 5h_ϛIC7S5:f$3.I$& RI$)&))I$II%)$I$IJI$I$)I$tI:I$I'L$I2A$RI$I$I$rI$I$$IdIJI$I$RI$I$iJI$N' JI$  $H4JrRI$LS $IDH)$QH$SJZI$ H8 %I$Q$$$I‰)%)$O)JdRI% SI@ʁ~ѵ6ݢ|xC&ᶵsnRkj; 8[O%?OWݐȟoo{>1V{@Џ?꜃q~|ؙJɧoA1Sh2.Jf۵Pnu4Sk[5ƷRw`i%=,Jh#9? 6 Kvp݉X52-fK:CuU-Ӯ4뱟RAsM}gceY{!obJFl3Ѡ q{yω;pև5k@5\s̬V00%7Gy-9wG&K/vg64WA2|R/.r81/IݵH{IM4 `fsNGg,gI:ejO Tnv{m'ѭ!FU$7%w(9sN;C{ɡ7]HD{_g4Hǹ] ^ F6:XO aPnITp7;֠w)bgowxpI>l[0c]{= |%D)]sjis4w+2-]?J`:jtwRUy Koz{m$lV(e-G#%ߥaᣔL8n~S ̀ []o|PYf mɹKԷ?J?Qf]e;WzqT?9ʧI_KmژP}vo`mv>(tG;\?gDdvū^̆ +2қ'zv qTGE'^cvAIugs~^|lsS{#dلVQãlڍڈZxkIL{hU3XnGwj*/h[ATm6+4J0w~c?ڭ9䔕;X$nm3!J9hlm-$h[UHuK-6Lzըu +&;V~I=?G&Xw3=ю+`Ch;BSc7yN?HYgDί_+juvI+[a;ðSm 糼? nGoUST1kfZqY@찓,߈K|sآޥ^^ l~v䤯5Իc^&ZX0]7ҷZxwvfSKal~;7W {}vo-iy h{#]ι;'w(1o[]MXOVc em\9?ȩYRN ɤ8WKrѵ f~u}ߑC[RK1]ףh~kS }@eV걖=AS+u6U^#ҷVxj{r}ѣ]u]ugk |ky N9c懓egm@>F]K>-<;L,!C'MẳȩMwK#{1۹.?*kST-wqiѬ4J*}k~$ oJN=*꿬9 `e-wY>*cܭ Crʷ >Ztո^umdƃp[?GJ{qewwfQWisRch*T7i?I˩8sN%wv_*|GIS^KeXe}^kr{b]it^wq3o"cf6'?9?G6t s.h/'8jwFu?yxO/?Iǒy'# Q whH#ԻK6nFuιJڝ9r{[\\ӶѠF A2?ggF1Z~Q>N7ak~_I 0˟5Y?6xs}:.T_{7VyjnA҃EŒHm>mÖ.Kjm#›w37֣s{FqPaQ%X]J50<܇cO 5?񉶻8vo$SwmƤ(g A [jE;Y-V}ll!@p[2s8ٿ%(%O?J7'SXe gw YGv8i'+iss%N5tkhg]h Px=i!+(nSEiiU}4p5>ÇяE!zm݄eBj?IպZ-<$YK &x*夕 1`.Kk!(Acop.%OGJCwPXӸ:wjTc׿[?5"}e}Ij;cbXj]]sv4WCp @EʳiոGwf9 *^˛K}* Y״S~wjS+>=]bC%m~{?lEvvW.ɨيYLokr.>CoOdZ8ۚ{A3'w#߻O5 O:6>GMv mn9Ck\9 4;һ^?AJȣ;<=='@A(gnVk?95 lRxSdd<55Ů6wZ{oX\I)۠=s.)oPPBG"_}W r;ihT킟f8I)kcG3OEI=}ןgMuO"͜iւt=)WaÊ־[VC))Mh‹,=S'x5eC.mKgU<mUz}xNX=X7UݽV2҂kCnwJsr|68'hT-aRf;w?ù*xϽFgf[i)vIIK^vF~CjoGT݋e{XEzSOF0>[?Yn-CV"#!.@R8Bc]SO!]XVi>#?浮p~۹?_h}©VF?}JJ HЪPw0+y=p:BEVvYog֫ٸO 14;l5a*lʻ`~c~,j2Y{`N}7z!\nc.=X I!gtΔKq8-:}YlCqm-?8vc>6#{X7< 6e4|ߋ^(9]Vu}˜QEۤ! qQ{։F wd Mss~oa6.;tVOd?QO|REu,ik~'0K rN ;/;:xl/*Q@fI vU;mmy$.22~C*C@;cZ!J6f gmC-S՞DukM8<ovK_.\Dʭ6):NVCJ#wY{ǃ[lP7m*4xvh>JIc+&Z{2 ˎw0@NԤݲl^;UZZ; {^{[}=خxfCsYRֳz5hU[X#Ru{(bձJϱRJXMĬߡtn-?iJġnrݱV*wUf3~ψ"4%%xt*nКP& T<\xUc]aOLg><~*-kt\p#jYRZɍt h[fQyH7i2jGy. C;BqN=eή#gۭ}Ȭp;$Vih1mS/?2΄lF40gA[Ō>RʦPez8.]$ :u\5H8|Bkw:=~ҹ BMkz. _a#t|ϳ]E|*~qDq8wPɫdwTr l=՞M6<\},譊VD_9onCͯӽZ?W>@ɟ{OT%3*ݹ_<[g<[ww,w q~ :u(6U[솏*үHkY rVkÂzұ~xJ'YFA@Ӫ~#dY鰞qj'TZO %'?(TV {']VEueN:rYmUD}F  5)Lv<} 5q(cc,2>Ϗel`h:l,čK2]+6l#a%np{|HRw~aUs'I f]/8h. TLh+]Rl_ϳ^vIFE[qۼ{6ƺ;u]R=A^yLcdAadTO&S-jq[rM~ lLjCTC ohpলcKOu[ jw#>nsEm~avA?V:FĢ<X?4 ;-C~Lj:Y#U}׳V]b\IG~VZ;iJMnEkGc;.R6IBǿ-/BA$kW<^9@9Y%;u̓danaZf OK#*y4z%G$hKnk7?QGΜXu}'SpxJ- Oi|k}FkШ^~!5z [ u$xx!wwEekO׷0 J謱9ϒȶږ;|:05cǶB7R54 )'cfP>`_̨b{ӱ{RRK~9}O}l~M5sJ&J;dIc7jutYG*?Ak\Q2oNQW?JwNU\FcV0W4vDٔd f c5?Ulc kShzvpNբfno/*ؖ΅/Q9qiЄ.n1ՠh4ip{t!jVmIL=5 xX콦\UZAY8W_U:~cr=Q\3`fTL}jkYETk>v Bw48x* w-}/-en1$9^;{|GEi {];+"; f3uN%zkB/6n-VkzJƹ` µ -$tj[H$BWH5*pSw -wONk[?dugs $ШCm3d%>!q=DujSi̗ K#6f;~jYOlt{UJk;$&lS׀\wZI*d7>V>\.Nh YY'k@[-{l!Ձw@_T9]88oj Σ[K.L:V gn6[2Qʶ[=2ܚ~U^NW]o hhvpuaIM;}V#ASyÏffkR﵁uZdW~̶v*]Iom_郿xKXqH?N$ծE 'Yܴ!E GѰ~)arֽZuT9JK @W[[WX u2^\a< -כn$W]l-7n55;KY;*<4HHE# s?* H ?}9Yg-;}Uٔ2Yl}Mvo=SwUΰ+']}8n|>?}e*ѳXp-rwETk}$;Z=/qVk`KusjjIsuoOv8OCF+Y;Ӹ { sgMN~))is$5]JY <3i \?*Nǣݜ/şi)pLyGᄺ"~a+vK 1@Ye4jnP\{8g_O~aOY{c;H׺#OQ@4nua<`zP(='OMht.(UCD],2>3[ͺΒ̻h^ .w{ÿ7#)GkZ㰙ϧJEkp?!\6:WFyut_hgS+_qRij9^ZݺonϧjSږ;X^ A $4^s"LZlpx,wӴi|âII9cd' !H $I%NĤ$I4R"E*I$JRRI$'A I$2yLI)vLHRRI$I$I8*SH O RI$$4I$t(q RI$7)J!*I$H% 6RI$6h.Q$J3$494J RI$HeԡTB.q$6L)AB>43Q]~䒺.:I{{:¸úUN6[2uTNI$7)rPRI$)HIJI$)JA"I$IJI$%)%)$I2t$I'L$I&:$I4I$$I$I)I$I$IJI$NRII1JR0TI' vLH$$I`$$J]ӨΪI)I$Q'E1ƪTI!IvI$)$I$2HRI$t$$Id%)$I$IJI$RO RI$I8I I$$I*I$L2HRI$:?Ȩ_㿬*oEBcUa' L#ݬ ;I$3.I/~ 5h_ϛIC7S5:fN3.I$LIJI$I)I$I$JRI$I$I$:dI:dIJI$NI%)$O"H$II$I$I%)$IUnّ/Šuٴi)v:- lMz;;g*lpxiƯ%l,J/R{;,c\xIL] :\LVs Cm; P1R^Hh<{OV,pn@lZr[CCxd{]a+ѢHgo핀u%E9)}FKI#R6Ҍr;1owⱍ^8ˏ%6%j>BIc6umsx+C>(e<$$JZR:R ߉g3FfP {^>O!Cw`*#֌SGtɛhpn-<iyE-ǸX l Ѩk1/OxjNk6Xa$ؽ1KtrJ?i(vnt)ys6S YlOVxdz0kB &ɏ?+ع53}g#+}бxDuJq!pvE8Np%4JbZ 0/û?{J^6h[;![r΁T!jVYk,p-)h{`7iBjr][K])㵠[ǺLAe:i ҄JIԙ=d$eqH:?bʫmƬ~9TT[sC.ЏQKk&(UcCĠz՜׃Mm hJ`{KKIOpLj:Qv]3Ev%"ۙUM|JT> EoۅU۴4#Tiunr>滳4Xb#[Mtiʋ2a$wJZi2yI5ƚ'M 8m:ʨCNnѹUej?pKL{r=WRUn'`dx{~ +Uid8Ѵ]2})X©{˿6bRmw\.JJEV<}Zl50p*n0F :Xx(I I$F;o\9 }+]{hn|rS{lB*IE{ v8RsnC\׊KJ|AwVw6Tq*e$aQ%-.:Zʵր *} MUIՊe, CBӚ[8Hn0` mqs̔m2=Vպ I@:I2Ktj;& 5U _w2]I+UXi@,>Cuf]BƏy%RAUB X6hB-TRöo{%Jܷ5 e0г_K%Ѱ|Q-X㹦@qҒ>fq ^CYVa~8ӅH06ARkwX6ٽF |to-(䠖%k[߻*u(caS9ާm8H$1ugR%#;,m1Y{v<|J5YpypK[}+7D.6]ETN V[fP\MN1IK^jkngD{`h3S nbjOلQPO֬S)hc Pc(hocv%@%/䐬ֻs$(UL wڟeWٿ5*q_kl]ٽ$5TN欹+ܢ[}:x|Pkwv?]t6Z9ig+YBJJl&}s}!k2߻JYsvHUۇ{t}nG?bp))fF]Z;UbKL z^A.F{5Shq)e#kIckK kkdû{ciY=B.yZ2SgJnJ#u,]4}T[:^=4,\]` Zr=4IKcj^.c[YY]J̯h"qJmx9}Ej}XǦH?Zb2ywAb04hn0c<{tt/'چ%=,fn}g`xZ/~586=W]W%ml5k*mbY{+DR/+o>CNxtZ1ϒ{:>(ٌT%KH^]?G-iS~e!5]hi'%Cw\Η5|Mhɭ\t*/7Q B.WSz-I#MJֈi#6k&G:Y꾐c=gWanKrK8n:lc\;L}:) uX#vC|' weұ{AjTO2Hnz> #\Qd5ٽ M_XJ} 6C~)GI.gK?;6?@jbdf]g஺ >φ|RU}p932}B2O(`RѠR@GhҶatTzj.7Ln,ݘ`7g۞NC;4$3ǢTf=_yOT'zƊL,D3GLajgfO=:'%yiwW{i|{;j;BQ˼J8N8sJ~lpImxli`1fGk<;my$::2Ňkwuu|}sϭոU,as~pskTjcTQ0W?@WAQ…6*=Υލ"KR,?LȰ5<*I5 ZnߢRQZ>pw\ *UwGQ4(| M㸂tm(~Ӂ£ћ\|螬0=_,Qo ()d&,Z5.Wz\+~A*-ػ_H| n*lH< h$)u>\m4$,(~CV$=2̳Yܕz:s},Q/䕾lz > Ü$u̞ ;5|~RӺҳr.e۞KU>m}$'@fIhzXD ٌA:uϮlp SDZ߲dkrph`ݻGG?*M$zNk١$ }ص r %IIu@28OfJdz.+/ȱ--lN5 uw?"[IBui>}>[ '" Z'tO+,::"b06 ^9p`K*o />{ce&\]I*;(SU[y%Be@Pw?FoFmxԁ;{Xj}VF6 wZw?#w֤5饴kBNutHwUumCcŠ\3&toxhI=ZXRw+?R6ZENm/g󿲃=;{]?r՚6 ѵ-}Ե_Ds/kFRCd4ɬije6TqqJŏyòc-s\㺰t*6ܖxA]~C p}7|U1ݏa߭ 2g_(Pڪ9miЬcr}i?nK&75tU7$5Rտd(Sk#MY#"\*aZZIkb-N |dfOǷOƵ 6gW6Vw${t=&'>ZG*FN鉁~L6$UkI_I3ЦF*%l<\O,QH/#f{''Ut~stw )qc`,cO@ 6f'SGDH <vi\ jݹ)W]N"֍kCùQi%){FOҘSXXN`t';G=DrbfX͕l'~{zIFݧ@`&f~) 0]Vw5؈״0^O'sS/Z~~={ 7@p3I ;Y ({t lj{$y"YO?tq\rww?Iž>Yx-6go;ջ^9>⒑6> ׿AL6Mp?H&@>)k4t纷OonnkT8[}k 쩯;i!9],[`gB,<Oޮ%ʓDj !tI&&*MQ'TI1"$I:IBJRI$8(,R >'Jh:G|tI8֭{*gj6|UNOtNC*n* 5I$HIJI$)')RI%(LRRI$d$I2tҒI$Bn$$I')tI0NRH$I(JR%)$I$H$$ITM !I$d $$IH$$I I'&RLJIRI$ RNI"!Ac@I )I" I$I$I$I$$I'L$$Iߚܰm&!w AA$TWI$~ 9iu_ϛIC7S5:f2ETf]$H$IJI$N$IH$I$I$$I$I)I$d铤$I$tI$I%)$HI$JI$I1JI$TQԤI(I:I)I$IBt I$'I:p RI$:xKRI$I$)$JBI$ИĤ$J%$d$HN2JRI$(HFRI9M)%I$tਤRI$I9IJI$KR%)$RH$$IjI1%)$N8N4RI:dI$v$I“O5 $IJg($IJL)RI$yM)LuI I$NBHRI$Kv!p 8]=8E4WJA#aRI%ZF'{??j'.| }?/mhln<5ko܈!lD1SY9ja;js>OL DK~sPԉa2 ??g[4"ƧL'!94RqY:ս kƗ}t?? _NP9i4;q6u&\4'mO[lx(!ô7h?~%1cƮ1o;''3#`:ME1o7e`G{vq{[ jk~gA뤥GD?_1դ)$K־8_~ĽVvO|mFl?ZEL.yy%2#䥰H:}ɣhO@*6M b%33qSes#Xjlii-:f?{ZJf ; qHNl$^y?#Fɱ-#Z,h}Ρ?ĕl$Y uQ/m\?8Y^Oopߚޥu#5L{<5ityB$q5:sĝU84IG70KKevTó :vGin`x5%0tcm:7 @(PbIi6>f Z6X?FuQƯ$mx׳ YVaVVDjlae4QZ7W/s]cDnG-*B[ޛVYp#ei55oxMi{+J=9ei|9MNvcmb'F]睭Fu,n# J 8D;.x`w(Y9ǀe<4jK2azՎ?>6o`5Rg4rTf6?U~fM/4it5/-+A1>k=e,KOdΚ[~<[ljX\{Zw4S F|c_te4_xwW?ZCsuwc#.۫{x2j,;9V3$w\KHc~Od{,mM/yQBZ2?3n?B,tf:ߢUVPJ\dsWO=W\.f~Q00@jx dI)-C]$qSOm:_ٟQNP77T^{ >ѢPݕsd 36^?"Ja]RӶ͖jc\ݬtUKmus܋*i\| 4pM<+e`l>GmcǍRJ;u']AeaNNugTn4PYs,?E$;d:V}h{x[r:46Jjn@V'hTk}!\/mAoխҿm=ju60@  cooUՏO~K_k1oaٿUc;d$:fuU@O ~N7X{vUh&րu+조I(tkiƚ7RmcUdTih,H-T\e 8 W1P,lx oiu,$~E _TpK'&ߘVTvnaё7VyVx>zv«̃_[P}mѸ;@U:Ydgb*Hېe]Dfᶱ|b);6Zm=AH]cqkg;9ԨNG> O%ƪ kUjp:m`5;*?w"6տZpi ]՛u|IVzj-6aIFwVZ{w3;QTn?)U{^=+PRv#&GEK#%rPs\Zo_ /{ ${ x*4뼚9q싄4>?=,VO^?c8;ֿ[?4Ԕ\Z_a^E)״ѧFOw ht֝a7Rej[˨VT5f]CW~.ʌk6KHEIC1+2{7(6TGjAkni 9Swg{5XMVZ卯dznPPoت8Xi^z4j{Ks$3)^emz:*fXK]j3zZ×'BO%:۰@ǒy)エ7s=r#!O<4wPޭꠦw\o2thx%MNoς˻+[UcFO=M7읟ɟc7!r-?LG`ʛ#zm8❺MTRvDZN?ĩ on-O.4;%wӴmvS y 1{}kڒUMƙnWѴoYdDӨp{:j-EUGOjlp4wx]m =mMno;َ dzOYQ}nqM Ys[ܨd awh!,\cYm;<;sy hˏ)Qv9wE>M68?zk? [^X#y&~;T;!4H V;%69oQ9ղ{Vpni @ȑUS@h)`[wZXvC!"u~ mn@amV%wF{5 䜿f>7GP݌wIMa(47ֿFv܈1k/6락!v jO$T(ݐ!ܠCw泳^:{u `*t "sioAKlv5ÇB.5?lsZJWQ̵pEΠO-UUh^[wT~%59ݝՄ[B3ӺԔvrj*uD=V6(ngvxūJ[FP?9 wX[#W~k{5%5cv SCvѤ}"5[}4o;[KȲ+E?ʱ+*FKC[;gS'\Pk9Q"d|iZ4zûLAr*y/{|%o%6Zy( +s\F揽@e<{m4ݔ)ka%~l}k5{Ð%ޕeߌ۶>UegnGxƤos?"]Ƴ?B߭Z*ui<4zی|2)k(%y+XIcGю:Ϡ劈DC='eUtin}\nYbv^ӿAL| j/Se7;>. .A7ƳW 2Q-u$G=u+-mCs GIvcX粲qx˻l2 Ev:z>AIu !ðQTDX_Xf IvHG %N}Gs t1T;`JJNhpskpQk]鹻7Z?F# lѾNPϊ2=gJKpC(c&}-xlӞ#d ?WuLuC ?Vq' {SON~MM{ʧu~UiUHC*3%Gq>f:x0S<$%/춷Rr;դ;Rԡw>bc;)I5Οiů3.ﱿ{G9%Rֵ5K`p5* `"Pkѧa|q62O4*w,4+:C̴o`znkq0<P\ )>bRf-mIUri=Jy vrѨq7oo`nZWI`HLpQ͒xR)A*UG]C$jGO9ee>ei_gvhIWe=/{;/}?LH  fhoZ q'S?aa<몿z%]ϻ#)Q'FN2a4FooMo5ƃrӬHpIB91ʭ{KvR]&qPEX!RVlLt9b:^Z龭> Y>ޞQ?"JעJmmΟgCr|齷hV;5TqZz~w Dcz_kuH%c7-WRXKE座y-%Fiw~zO5:3KobJl6m$e;}#@(Ps9I?wROa &`xOIںjAme;8U0_S׏wyI)XtRe"\¡}/hk*׶f;i|We~TcNNy1C̠W[#;J}>eXn4s[;']a@JJlYM:|˶晧FmTS6ER*NtIĬdFc H )["XRg7H #i=J-%:Upķ"jLxJӵY[[$ص#UVbtʩU/eg'9nx> g/gAZå9EUNPw8IML4HhB$?V?F8,Z~_/3Vom~jxuʉc;8{\gIIrsmETU wZnS2ϴ>h}q ZN@WiћO⅋TG`RS.7S>aU=)dYZ"?t+_átߖZ5B- o k6_'8n[44͕[VIuOk\RJ+08*.ʰ{$䆉^ #u ǯ;c UcWWNuFKԷF_3I@u)3F;8K78R63WS{i8Hj |n?W{מDUrn?$>^ <֦OFǵ>!t487I"=ұgW=¨ǚݸhBwHu-oOSk{Ƕ}i[SnaciFfS ++%=gO$ 酕^Y9 =Υ,b))ӯlmv+nak!VnS6*=/1՟=ŻoWDGK e:'}UмP)p8NJ2'k$>LEiKOcXG+|?9r40L+# X͘ ix-nhXBȢFwYhMd<=$=N>K!2i'Y8h Iv7-ꇻo2ŧr=16G~jM&DVt7WmEIvGSHl;OR}φDea? ˜]SS>',s^~v& V[贑l}";|A40lOKr4OTc?ksݫLO+XGq6=%I9͚˶F?t@4Ϻ|ԣgNɜNʙulyA UOe> դ->=kޤ}!b5|IL?vhs߁;T/q?[??܏ H($J*$־ 9h_ϛIC7S5:f'UI$$I)I$IJtJRI$I$I$$$NI$$I$I)I$I$JRI$tIJI$$I%)$I:I$$I$I)I$E2xJRI$I(O)$M 8 EI0 <'QjI$).RI2tRI%$PIDTJ RI$S')+’I$ɔJRI$ LQI$t)I$I$JRI$I%)%I$y$BI%"uM90I*I$āNҒI$ tnQJI$.'I4$RI$4RI$2 J:'tPRI$TM)RI$SwNN$L) JI)I$x}{Z9?L V?fƧ2;-"63ݮѬ1 v=T Z;EVP54%uʟ#X"=UX᦮4Dn-d[MbJix7rr:8@~jwfV K&2oSt47:ƱZA$}7,ڈk!5<_S:t4ŭ\4KD@xiėx?W4fþnّVw0 ~_hkkLM!_`:NρY5ۿjtiyh<!}FG什L9'i?M'}e_pVŭcauWgeδHIڲ&0yx"mshQSX0 IA$9b s1w?M뮣zWd֊k9*Yv<փm@栝>0>Gޥ[iż5SdI¤˜&?Ta׎։ Z֑k˵ aWIyq%nכ5&#vҸ%:7BϪzý& Grj'Ҏf{ZNGb \6Z;vwWqn4H.q]aQ-,3)A`s?Wߘ??+@!6>dDZs*(2#nX-=@aZ/j )8ya`c>jd=>`Lҵܠ2.x7*42@Y``cs wEROHd4:ߕ}9o=\uGon- zYhE:S`\GɣOT'vִPdD$1*2"Ke $r;_,\ZwܼJ:uvt㺩}ݿWh> \󴍠~j8sr= Xvjfʟ]Bv;]cm<@RP%%ń4pTXa%L7vH+)?nnmG խgh鮟Wj2 +v1:A4 kBq}Uk,/;dTsy_si5# WfquD ;kW\O8QuZM\_:~mg]6Z=Fhh 6ۛ 'eOv&ĕW99wEGt2JzꝹVܯu~-N׻+` hm-$$^}YoGcpun1 puY~S)q˿5‰$yǒ_?R(z[~sݠѣW[/͟_WZ֒ < 抍Gҟ5V=͝?Do复*Z=ΉMā_=E6~-X5st42]Xx'Qٰz1"pb@i'f`pm( ?vY s#P9Z>_O3߼m ZZѶ"7/Vn;?iЎAU4du UYc\wIIe'*AY`s+ovH?46㵺V#-QwgYIOseAߍv~iByndCn5qS0vzGn&m͸lb_i[HǧZhiobasϮu|%y1^' ? ˠԛI?8~wZG06G޵l<gXVӿgcX]{vT_sU ͘=Jxwj*?]K/n@-= !%%!k;d[}5H(*2A8׎qO')oy4+;T뼖0}- F{x(ՈG ?ڭe{ sQ+v[7,vx;Kj}'ciKLwo5ێve>>Dzhf;v0i?r5#co< [~Y^_{lٖ#h=د~:2OEŕU ou' "9kgX8׌w']f٥j;ꠃA L+coh l3\G;Rkz}u^ӺHӼ?!joo]G- 6P{kV> ~a|FU3K]7Z~]UPߡ:`>vu'wrJ݇bVӶ,cKʧ{2 8B<)cVR^$>*Awgg{O$m6O 뽆I Fg(=;t 'ηeeghGu; %.1)y ,]]-xn jLvTuq$]ޛ@ :N zh4%"Jk">(dmRN$\w}1:5V$5\2dUmppwI@FUk-y~w*W}-w 3ncX =k 0DF{s J#VhlhQ*Cy2hXDyuN(#P=XR pt. ڥ8%][yh0 rt[]ty*="[!Hn(MjVUlMK{0%GO+ƍNYߐ@խXb8JJ:+\!c3e`w.EMl{zN7sWXM?:^0VG=V[7~cxW8QW&ZFSgL_+//!)?1g@t~N.#UPBjim- e ϧ^*K~Q`[i,ޣzX4wYֺ̭)+m7k`Mg}7O _R\U'@]sF)orS+z'䇓zxk|RUwY FK(㯂fs;(OOӹӱAzp3Zǂs>kWodI7hk&%OMY=*9Ymmg~K.]k1+kekC  }o^\ 9=ɘgY7WX^ޛ~PZuSb=6(bUO'R*:v;zu Fhx7U.r_%5L{L.U`}#KHIGO/>ܧ;ah+x{/&,a3BJRUSkctfCY'*!ݠK0lxiL)gt{p>8SMdA=N[h"|B P|Rl!x[[۹@T3&}s"ڶ6hpQwSdLud4Ob ݜ! NL(ӌn<+h8ԨAYxc88q{2p8Q?KҒf͔*fK@Ĥm$,ߎN W%dx(j,FVOq#mz6-2\ Ux<}ۚeUnm[&~% xƇ6u:}tpU:/א`Ujp=O)\+VjGxnEp8!W'O-:b-%FC>ShYIUѝGA|io&ioLzY%$ t?BdZx47~2x5$f=d~?"S>ƏܪM557:[Gw-si4!\fꇐNNA\a$tmlU%qSQT{od?§ ާpǩ5UfRԓVm)``aVn;r}&fw MmME©r~}gzU[PpߔtѽJ3\}yV11;c,ODnvIVB`a lZ m%nt 'V K y_4~WnwS`4zo~[:=$,MrsQ{\zt˿(UV#|<^2>-ܡc]}qNGNxu/:n$Zbi"]^HpP;ݚYom_[D-ꙹf?;o2j -uf3cOի,bWx>&5B yYTC)&wT݋n1w O϶2-{9%3۽vp집MYOZfMYa+/-`~刯m+§FW^[g<R88}87s4xxdY^(]Q.Z1j҄i{VɷҶ]Iߺf1ϠL*sc^=ƿcvkϰ'VO/COn b,yyi#\FV8z_pԛHhΧuq>MkkqLPPWi?uS\l6wCIk-z9Rb+z9e,{^sy[~=Ow#Xָh̫I/Oq*vb\~h ێ vGkU[=riky7W.v.?TRߦ6~[{qNc_^c]!*[ɓ[ ήoT;kSoH`Ɂ>Wʦ7@qojL8UאޖmFqii'O;F=$%iۨz`Vӂ4kJu:+lG%#Q*\w0c'LgTvCy?L*3'n6_C]>{@}M뷂\xUHnFc_j;s^"v~ 9;6k *h`yIj:,\'bAp| U]qNYcӴo?bkm.s5iCA@ PFHкngJ. G k3]< ppU$L5Ψi StX,hpӵ1NO))I$rDTI&NbI' D9%)$H(IHpTbI'D)I$P94$N9LF )$Op|N %I$N0 SI&<(wRI$'Q RRI%4AAI$vpo!P%Ymd#&N 3>JZ`6# $@Oqʤ䥰BLE$%1 I$S$IґI%)$I$IJI$I$RI$JIJRI$)r$$IN%)$Hj:' RI$J@BcJRI$I3RI$JSQIJI$Pt)I$}0 BJRI$' ))I$N)Od$$IƁKR )I$EE I(Sp%)$O)E$)$I<(IJI$)')RI$xLjTI&H$HRI$I$I'I2tI$$I-~,wW?Ȩ_㿬*?,?d<A'pPI$6UI%־ 9h_ϛIC7S5:f% 2$I$%)$I$JRI$I$I$I$$INI$I$$I'LJRI$2I$$IBtRI$I$I$I%)$Rh'ڥeI%NBA=jI$М7<'ԒI&<)jI(sP $$II:HI(TIJI$JR*%I$Jd2pRI$t2$I)1EI2$IIJRI$$1I*I$'I$TI8I8H$IfLRI$;pxIJI$A&"$I'L$$H$9Hr:$INҙM $ItP<)!@AI$b%1:)I$ )0I$p)%knx-HWU&Vӷu5UXm$@9*rObb6"~wvk]YDl]k#K{:iձտWv?%Ѡ}"Pld4BpsXf4d'dp|J49J?KGxTT"9xra8TKPuQ4`/w'6vdc(h|O錴x<N{~JbZڕ D(> RP\ <i@pTծ(ֳն -;#o{~RMOXl= hOoU.!?g?uy67Zx%]<砹hP\0=R|\٫pFVI\~T>v䏣qk- $}ty"PDI^IywkPK4jt|7 Lr.;q|FïQ.<I%/鲝l .uPT\Tbgzn.{V2;G9 *%kjWSnfBSYQ݆_hgg&12rx}+tz#;Ho#K JΣ ;Fwtח\Z:ƇswIC! {|[%&ִAn->IG. U9dqyi7~IӳWA % ԣ,v~I׶{Wu::1َ!SPq ϫIhzJem˾CRe bc[OᴉAnDv8pB7i5dl8~JgmP(j0ua)p)0lwO2uvW [ђ|9YyU,IidRF-nY~kSэoi+{$ZmM(_+;7Xxh(d~/5Cu'y(%9%N {/@P7rxgIqhp;[;x7ۚX E%$ u{Y58=PH*MdWqQ/M=t`x-pUIvA?6$nP6U7lUONGufǶ5r޵;{9Gֳ3P,g8F#| aTKELk7ѿwv=ߚ;]?c .f5ΰCI@Vc Gc 9A~ gvrJl]Hhj;Yd&ZꝽ jousx;qs}\`HP?mj0guT8o]O6Cp'Z=Á%%,n_ocmn(Ya߻E *-m% UUy= [/}4?79$+I#Sjn%3a6n?yA>6=ֺýIPPݬKwMZ%$\F\ۚ+pnKr7oBF0pwNd6))-:mw*Tdzcc!59#op~-M}&#Â/^WCpgf)S_Q0aX.hD"Ih?sE b};@( kv^0ѣ}bw9٤m#~Vښ )Ze-j[I`i~wq}'oQf;v3{cVwrzm-n[m۟0=1[_o>eZwp{MZHo![oaY]RRew{)m!XSu})2cɫ'QJUv )c2F|[tG, Gq $j[2k8Kٿ6[]+"Ј*(mm?SăeR˝k8iku'y%M6 7{u;%4}S;u;Ck `Mn${-m 5QE & (ġ]Cn{)3r[8UV ;{CaIӎ㲕2ݫ;?&d?VMYҒ{2ӡv(diO3 nGwoEWi>cnl[ʗ u?^K*H?EVou I[nݝSn瀧nCc6y|SSjhcSK`Ƭv=[ yq&Z2S6ZvR~3OZvg[,?8+˄I,sPEߥvpKuy"bm/ϲ {ʎt c2?EÇrA/:8whI^NK-1%MMVF죵V8Eit*V*&}:'uJ\MnսbjF YmiqJ>& f+w+e u'R`r|lqUI(bNk}`4z8ݜ`Y ˽6PWIfXԨՋ'}#UCjSkj ӹIQq:}ܕޙF72 2l] Zĸ)iHW'uqZؾp4OF5ueZe%it!{}>*((m6A;%C K쟯g11_ T>Yk<@F"3zb$e;յ'MˎWh`ԓ%Z Zo)U3 nro#ëbNJ۸|JI&'qN,>y_[XX@ߣG1>" i uYu %M}"E55 Fq=;kҾGG fd{[<eA VE=;I+ߔOG=ς.6iI[C?yY+6fт6P%*WR'k{7KO%/4y%1h5w@n5GuQu̮.7Y{'ݑϽGYk=%y6@P*~W'#'cQjq*qqp}֙rGZƍ%:ìN IWٮo'JJzvӹ; CWٕ?3m/\L4AEz.)(3)sR<K2}b+mt GV*c_hr2 :ܭ.xⳞN9vRRAq[ߕe hh쁌O~V_|ۣGd}-#/V |q  JޞWjK3o6}3> ^}!{Yq'~թJդ}Tx~5m)8=ImO5q[ߊ:xpr3 ;LbX g>FYG? ؤ:5,ԞKv±EHjΩGWW ّज़,m R1UǯvX*W2HQ?dA'ĔGi>J+gdz t :]d K߷VS4rT_O=Icj8<Fn{.!G?%śvR{iŠcmUSꟹ P̸PĸZ8क0u[ q(ePBE"Wya$4ptUpi>vZ=g[XX%8v$ &VTSXKZQ X {Ua>+C_]+;kKp*Z)e Uwk?%y.VܧFND27xEq tWTxNKOyJM?7$*]I۲|Ѻ%ewZz;=w{\qy(g86 S;e~r ֏^{]{p{*Ǿkb>5!$wPgmz8~*!flKy:պૹ'*nA~kn%$虹pV[}3Wq(@괱ԗ;`;clG~3fcP⇕o%l暞ܪKग़X̆k@FùhQ1[i*Ml:O;Oӽ@fS-FS=6d3Ҵp?ZP'AgT~XΥ?ܣEe:./D7 IySήʱEca++k+7sN!CͲZƁSu>HG9SG%[NJg~{qkhh%ޭH<wp-{$5CIo4LΪG@;?i7N`R,<[e 0>ڻBvo'Th13X7<Ɔ^;5)ʸqUS`ѮS+QǷKĤWt,ow wzsT?ׯV;'ŌWT~u 3;k. 8)]IK~vZg[kTOMqwn&Lِ=U{6xU] T xAK?}-ӛR5e'G+ܺTپ7Y~ontlǰ*JfwI%O0<&-Hr=[X/uXNqvJ;!hȘT=|_`ƚ#쇊n]ux54D@m%gX ;%l[SKY5THi:ӑ`47ϧ% bY wYR}7V/-A!} ]*]gUUƜD(d9N,_v5,J tpZ3hQJZ1Sa{D+:}B@ wՁkY,.Iy=JN׏} L܆KuceprK~ʎ>C12]$iYgwbIN3mot=]^ufZ>͚*fYV7(H<]w#_'Jm_]_؄fC~tY4Y7u*vbtN`d{O,[Ge7%sD[F;{>װX~X־V~@-v<_ƚ;\{<|ÖjIW]DBӥ̠S$"I$D&R)JI$'M HRI$ "TI&Hr4 IHj uIJI$JRBJRI$U(MpuNJI$qNE+uq2;]ׄkh6pM _\x*vd3Ԭ(!˵r^Su;pU>` *uF9n⌝~5Ad0`UF_f wgnIKC\m:@EƷnaQLWh@mmP@/ƺ; Zpjƹ%MƼcVe9?"цJ%40CS]ڎ7Xxh -4oûu7 lqs̔c:\N\=FrǛUS}?+̹h-o#;lUwv"s$U}W;]Wchl5&O.w70nc\}ݽƚ8r!Ak(ԨwKK "PD8>"7TyG) ǍGA5$;ҤnobJB[@=ug?U-o;k5J=ړ:qdvᝇc.?[,mM$nS~Cj~Fѱ 6V]JEA~SK, ]VigA:IGα"5xep.Eȱ[땜Qaacx?4}Bkmr<Je# 5B kQY-x[#guGSvLj?S(HaM=ђUvJ)dd<4ߒRZO17T6]w(5]跰Ům;?s49)):sj?AӫPtO4$;0m 8s,zS-\ As?RV:~ [ O&_sHc+7cn;>'\6r %V懰P[kIMzrv?xF9ӺÂ:lx:2M2lFWv0nIH{[wV{ڇ.ȩdd6'W9(UcwfkBz1 þK8GtטnmK%v@sElj=Wpcr`4̦8[V $Sb{)6-9 먕Y?sО]ux2{7-B{]˚LK?9#Ukmhs ;㺷_Rcr@e4k!]S;_P#B^Clh#k0VS(Q{on|pP2 OXizJ@SP؄L|qc}[}'CZ7Xx 5?Q1^w65 W169i7:=mc\655O͗U/q,F;Vn7kG@ep#VH%.K {RΩFBp\[KaS l`gdm*#%ކh7䫻`@pR.'whVEm Ckuf%U&IU ^ 9#9 Zk:䍋܆Ө%70CX:\5McmDչ M.|8hN}{K?o <4~e VG>J.}'wq)6@k ~ܼ~qU@*ƭ?8䕄ăPR"D&xQsC8HU,kG5wi_khnXe8]!3-hB[ۘv?K;8wK Oadk2+oA#3vG*>Ɨ@5{*`fX=䒖~ ?4|k8 AY5e OΥݸ$*mG$\W3e^JSps#َJ]ʛ2 \~o^Evk$͵d)]Qu.`E0x*!@󾳱#'ؒZFǍ*0QF?V7Xc._u Xe-<\f|S2a'+7fR(bӺBֆ'&9[YwaeC==~FF>)t.H+Y̻='qNڮkH.߄) G_'@<h:So:Ad_+WX |QIR1{=*}*-{_<:0ٌZ)` ^ULβŔhѤʼBv ͮv 64#cnS>0%S7'1?m |9Vz 5nNpk|(Վ'OMneGpKoe@ty{>eto{Y/2I[=7{IC¦(\4 6^oh$$+T68Rο4lOuq`w(i;gu nv!̃#K013ݱ粧DȫVÂH VRzQ۸xZ+IUz6hOЌ1#e0g݊}GIW{v5ϒYdPZ!T{Sk`upBAࣷ/ekU<Ήe>ITF3¯v1W*5o%YMtw]KKG]'?>%gfZߴb$2 dSߤ8O~8H݊Yݏ-P~‘Kܦ<4 ~Q?$G } _Sd}z#>Dd3Pp =$x0߉`yRţx[/,OD~! #dL~!,=LPTf>| VkVckD̸ĤvRIeTDY~c@%ص?WcQ?B4Usps;v[dUݖrc<WT}15i61wYۄR-3(iygQO?*Ķ0;B|c?{xvf/R[_ӭZpx8(9ac^J÷x(]*k;K7'д~Jt9 GR2jnC9NQ|.fy >elڇ.Yz%_h`$eFdk6W"T60rVuK9: pr*78 '`ص⶗YxU{F]ʵHåuzrU~#ֳP9N'MV>e̷ѯʳr zcuyMvu8 ]u g%lcWqyH3ULqAms1 BEMȿ&̷K8XPX䧶ɴ5ueShB hA-36Ɗ}|-8-,ǜ?Q3Q W<{ÆE^) jcQya4WS [NfNFvrCbqe}۪/%(d_]:Yɭn; Lndדe.VQ3Q,nx=kbig]]%wVEHh9Oⱝ,I$T-40Ջf8!!Z [` >*D!YcZo7T!i#, C[ْ8Ѓ?ڶ$|{̂t.~(>dfc> _QKMo7&jzJ^;}}\̳CNc-=w%_5tj8'֢#PݪE)7?|Z V~ILEs-iMuVx;rq46z؂ȃrH"lwr)C [+^#+AV&qw!O2JG1Y,x*7~yOԭ!Ɓ\sӱNgc>0fz&SHX4_'56kOVqkIA]I^,X1ofI G*]E?A豷09+S y;S 6c߽0ӫoDjH | ݣ} ]# {Ыu>NFuFoKGe݊wUn+ׅ5us!IW{n~Mg[ҝm*>5*غTK]S ?Et {s c9Um,w(6-* g?DYmh ad hTps=7m~v 7du-^kqmOGϦB|Ss73K(y#"4#-g+]?#խ{ 0ס ӹ%0÷x?Oc[^@`V~ɒk?FG)sG1!P(yw>kx~^ٮVm5J^܆?>޽ pC8s_Wdm9-=ςngЮ/ ;Ϳ*[,0t;?LN:'0g7K%2Cl]M"'W?}a c-Y wS/#[C?O=G8 \DZlxAn9gYw?0c_+e|)7k}-ӍLai.sSHV"5(>Wʏ'k}ԜZ \G}`~A,q&C5Pv[hkb`m=l}/gFziy?詌O^YO6SVFtnhF;D :젾\71O3g)`}"xqDǗIIEo 0cmg>6xw5chcˇ"4Chuv&? ߹aϊ4p4P@B,ppyNXI$:dI :dI89?(!I$nRHE*I$MTJRI$ImRJI$Šp$I. dTI')4LL)$H)<蓼RqH)I$dЧ:<4*RI$!?tyN)I$i125IpRI$F;٪tTH'LN Pqݪ9&dN]$P¨d@UP+JI$%)$NIBI$HI%)rI)I$a9)mI%)$LJIRI$dI$O BJRI$d"RI$ JRI$9)*$$$ID.ɊJRI$E9M !I$I'%)$H% %I$dI$)$ILpԒI!1$$JD<&!$)$I$IJI$NRI$H$RRI$I$I$ RI$ptI$'I7t?tRI%og㿬*oEBcUa' LCݬ ;I$2I/~ 5iu_ϛIC7S5:f:eQtI$t%)$I2tRI$$%)$L$)I$~&I%)$N`%)$I$IJI$N:JRI$RI$I$$I% $I#cs *}%nTI(KjԶ)$P:ԶJRI$ tTIDDEI!LRI%S*%)$Q> $)I(@ I$eI%&JI$ OI$(O %I$IBE9))I$gܧI""!JI$bPII $J@' FI$]#T"JI$qd㔔I8Rk{TA I$Ȗr43N蠤IDQ:)I$IHHSB(RI$0ݍ[[G {z#u|(aC[CL}lEO!4 Do64_LEd̡Yx]O͞?JV^ܑٿz;K{vz4A-8U .=Z~Ȅ5>}Brl='ʿFe1ejA8D/ג=)6H *#a K?>_…dtp?_?jiJo&{:h4?:kֳӔCή$4h*8G?QF!nw܎k?V6dX Ïq,2 \}?})50>mŃNJn-qV1N[7a?l:Ɔ]L3Z][[i65O?Pue$O  ;]-ieOߐʛT95Lwb+(6 0IL^\F8Ү Q$lw&sQoPȤ4GN;ti 3𲛔PﲂpѓZH3W5hd{1W&m1{]2[$H <(XGT"[بaGILX~T\otlhK7w,}% hs]ѣ]Sۆ8rEU |-#B' )%wo՝ݟO"tW6FG;Pv->cC5xwi6)5]\+k۵ooqᣔUFv0æ|*3[2>eV޶<ĮQ'#Q-7s@ru_賰Щo$ w!Z"S vCgTf;MXQ&ϵV[v%SVC eϢOYA$…v45<%6OY+}W([$܍eO6=29W.{-kwJ.Ny8lwkٖ-ݝSv׈!ҳbl(6d!͖/8}Z cf m)ZV֍?QevII1e?A38:U,}9ۏb,WKϦ56w%_s;73DCK@SKvs>GPM˜G_pD9G-?-P:SsK$1 gk{A#JntG\hyaoٵ+U"sw|G ?fWlniPAJ@̏Q<qL!~k?(chcBc_F,@>)[a8pU̷okp:桻 1۞ĔO.g{\C=KgsO,<m.s8,?4a67{BegQ]S^ \$PwQGxq}zԞ줼l U ݇7&ܗ0cpfv]QuC.9_ugL`ɫY٫Gog[>U y.碦WKcmNJ8'_VGM"Zhw eOZZn{| ӲW` $^p7ּ}ޝSum~}$xv5X= BcDtOW|{uoQ my#eu{}ƿ0j%xF .a~r3ÆAYEhϻi VM#o?礕m'f).h&UNaji>Co{NޕW%^ v.#g秢>Ph[?Qy][v4Lb4h35X }5N{GZ[G2V"$1iԸ8loBk+h Ruhk|[?/R,v9|zoy֝K.$M4wݭ E`T l˵Qf}6}; Z5`Knj@!_y/ykki $CgOrghojy>kANvMfccOQo{%Jq~ѭmGA 6jO Wn-.߼g\N?~]Ds@=O,ϲb9DnOE4YPau|w#-IQ$?I-l׉@qNìDy@슫OCPFb{c_sFwh.s@ e$.60aݕ-- h`0 0k\H#D>ݕly}}'T?C ^ޯk,>5@!ia\5EfkaYez 39W<_R1>h7K7C WN&mon6b9SRtʸ7 V:~3+*J] wFoU: ݓn=[Y.^SxӰMn^U7OǙ)+o١̻,>'6c_ODEc?g+Tn38VVGR#GǀVOĤ~>'uZ+RA*yY_ߙHWc ӅuzF4 ]n@;GnAˊ(+Έg$p\T-|iN[GЅOCoVDbv?NN%5'e0qCtURq~c cn@|J+k8C kx$>XBs~p#QJIM]^H|Qq.l1GHa(  f*'V_uX:)iѰ<2%XCpmC!fE pUzk;=YYp.|tӊ7aA }CXTm퍠||t!Ð=u C[]DVn^=-;gZh[7H&}jXx.^j. 'W̆Q3]$B)jNO#T~?sGnQ͞ IC@Rh⅀͵yvl<1S]/rm wZ=b70U3-E-]p粫Yy7pov]C/jy#2$qөyKem4%e xY\=6}my @+%[!ZCG eX`?)Z4RI7&eO1kU 9,nAm 5}H+yͧoQpH`ִV,@,nmwV݊.3AoU 'tL4c ӛXf4}IKmZX! UGbrD^}:xs՛P@g+\ndhrn}%IUḼ&Kyvlnֈq0gMMҪ Sv]a.aeIХy>(+ŠRv-;SqS:&5 twCѮxf%MbOB#Zuk^Qcq%tㇹ'AܚA,5=tZ6$<ݰ5@uf Ojg}N__QsYx2nM|VS_ÑJ%o=IԻ jahwV VQv*ZxΣ{!ZYAUӇxj1K=[3tMn+ N}d|oVQ.s[ઌ[>-VZ؅nAvpH IXr 9h*~k}B8p୛&u2G}~G}bu~°sdj;uLb9{NW֫oy.A XosAb9ۇwJؿv5G]yu |p9^XyoE^Ȧ>ȔIMD|\:eƫ4G^ma$E{wp|B8Wzm?7)ӯbWj{۱Eӏio>hmUkȩc٣R>OV}&`Ȩ?jK5 :,տ.c+p-MF!WdՏJiP5>N֟i2m?Կ6Kb2?W1`eem`?xB(ݴ@Xj>֖wOYXȻame@lo?1}7Lf]MsNY|m5fw~kto" 9g?PXO:b2x9S\vl9Ciml|jub"<%77k?uMhn?,mgi'q:VYhw1UM^cz-[;^~i_?pPI/cWv!69q;c)2DFK3QX`EnDif5g;!ׂkk?oQv=W%Jkh9m;5?j5{ JQv{zʬ7j?Ѓ250H6GR}}w8?J^-뿚V+''d>_E8jRe55Mf~_L}OM kj7`VXv'S#nR/a-%.\-nm %-HoIM>&svt>#3kkDhvԭ3U4 Y_zKZݽ _pxIUlyiC@ Jx<9A'OHA(Anz} sc:5UOcv: R)NS$$IL$ID)ID% !I$o4D"$I0DBI$LTI<ФSDTIKRM;tjjI&:(TݒRI$*'T&I' &Q$I3JTN)$N VU[Y *\u0H# i'u.I! Y>J+CV ҤI$"MBI$$JRI$$IJI$NJRI$L$I0I)I%)$I:dRI$)HJRI$@JZ$$I'QNI%)xIJI$%rRRI$ R )I$byLI%)JDIJI$)$HRI$QRiI*I$;˜Qw %I$CTҒI$I$$I$RI%I$RRI$`RI$I2JRI$tRI$I$I7t$I+"C>ߚϿXUnXCtr?k;N I*ˤK~ 5iu_ϛIC7S5:fԒN3.I$)' )I$dI%)$I$IJI$I$RI$I%)$I$IJI$8EJI$'I$I$"JRI$I$$I'2$$JU: xZ4δ'LN jXIE:II I$Q<%I$m%J\)t'P*%HPRI%T@I$QrP($)$Q)I$eI T1JI$ I*I$HHI$bRI$tTI9)"TIH& ВI)3PBM$II#I)I$n<I' aʐH)I$E1Rw $hJI$T])RI$NGlkLFoU[\`;R@Hwk DUdس N,4B̆Y-h7rg\ϣH7錭Akx+swlLKZg' 9 zV1Ej+l/ zZZ<!zvh2[y( n#];Ǽ[.x|'a;OE7=CO灻[s1 p?" Q#ܢCZH_hOK,.6&uV\ָ])Uf%EN5wpёK?tS+,B @9|QV;] Pm{"F֏i ,#F#mxkc ; JOX}d{|BaO{cs USpv!?hH~*3S.?I[μS\|xC:7 .y:vUYRC[jI13Vmš9'+iBRZfa*;KDp0ùBS$?0a^#k 'e&mchZ7R*~6R : WA[efZx)d*Pw6vw?[p?CsH;\ !I<Yۇ#cz4J>O-C̪k=*2B ԕxs};>cg4v|Q_K`(<Cun{: Y?f#\Cq󕊪e#em<ͮW5)+jqk|JqcY*%s\4hQk7m`<rskMFbl>?t}3g+cW"ǟt.Jtu-FxC{aegOmdɨSnzw GM!h;l?5"fr+q:qUc~hd^XZ#tf=6{:o-6Z9iN&c2e;UY8%!,Y" Yx+x\eky?rJMef5F[ mpkٌI"?2Nu{ T@P)I熎RO>;ZѲx(Z^eĒw\7}w%6,3m"H?O pqd `:rJ(.#x YL˵q8QaO?;m*W Շ&mslrQ0Uۘaʙ SwF?y!4px"+wR)jrZ]{ |Zx(rF^7V{xUh|P,.>#s[  +uڛJ@\clV h2܍c)>{ȑ<4*XݹJ8{[,mcs<7s'_$ =)-~6vu%8Yv8;P8P#Yõlc-EZ;UN0EL뺼F;f`>;x*bUk%0AW^Z!U#QjTgǻPߖ"ZwDѭۚaZG`AMdKcUxmxFP,ڵd(/nKn"'sV]JwOusݻEf'J?$FvoՇ9 0}١u ѮL;?ҥ[E3ӫ"5Z;6?"'فy-zb??GQd s<L RSH;̰鷔A8鈁=  u:Yw-̩Zg;䬼TtSj˧ 8FSh.oh8rk EvIo2hnZΟ V]A R̫ &AgMVH_wTcݦtׅ'uj`;,{,tx P6~˼IE:sջOROr I]88V\GJo{__z.hȦ!X J:k:{CvWԘ u*V{CZIvя+q#@%j1sE6a04wO4b<կگBmFX;ꓺ{#1vڇ$4S8ջSQӒ9;IIp:4P8ah@ )9 @IZ+>)W>4.w@s#%;k84?zJa0v 7>p:i늿1MI; )mO4tB 6CsM9D"YemaU. ɐva0Ӌ|"ƃx׿VR$@씎A(%8>'/ZAj0ֵKIK| d<  +T7;]-ScvO $݀e%/wHt)`q&R^+?SU6 ))x[BEҚ{PmNlVi ʸǵAMN'^~K<4P>i$k!KaѲ% ۏ I\Td hv8:kNiz9'>^6ۈ!xҁSŸ}eڇ4|5r'DLmLHB^%)#Dv̼wi$-D@ȦfFsV%@O'nR?ܣ=I4Ur1/G3*{~#ܙDZyt9$PH >ߠZ~Kԟ>%!]HonI,:bi蛣A5Vu'7!y׺\{$drP#@#E4>?K;~.z/o;ILJ{JgpF ?2QO?C=>#jo#bB^Rtj?5ٌ4{Qvh*Ysj\u$h#F~*8yRtͦ^[9+&N0噄N# T22|Yt &0a0T|[CISǨt]* kŭ[>TQw;@=Y-ϠL,#{tA;!{ =20;2yY"(m-k^$\|vc>id#l+=?5X cǒWEK`c;UL~CqB d%h4mM翷[xM@kmqqC)?`ѭDg!/a̼RϢJtSK7\IP/ѫK;),ޤ۝+~cS*&8dwgNvUzGppԺ{M.wfYKԤnis~}'& k1+Ihh#Y/ToӘk7بeeݻ$`qvu}Ԝ(c v $Z94ؘ%t`_^@@8Y^֖~tYYC^{2݉Ki,c½^\!畟gQAFUf`.U~8Z8W12Cdr9Z=3/ ;ܬCiobd'Űk2j3KQō^Ƽ]Xxs u=Y47ETzwP;-=ZYpC3աr5CUTӑe^(65WE>hLE$m!<nO)p@nvN~ I]VOqT24чW1O[[~ VƏv Yѣ,HweRf;S*k\AjVٿ|]-{5Rd#Bu+*6QFkwVv$Wf/Rw`x*ON[w]:,⣍d|ӝG]e4W0Ĕ# Կg=ZrpRm+g`zsuae=JuaG)z}I)3OWڟ 4d 㐫uߥRpw(cM/mUyŸn?bsM|RSp;G+YuHoq!5OfuE\q}u^Ď#u/Vq үB?))'O֤OA}ΑR}$j>*e\Ȝ"< Hd>*]"H0l #f6uWE1ܔ2 Q[<\d}>%j ,?Vfh7G9QWj쭣,9Yj`*-w~Z^C[[L KJ۠*Y˲4pٸHhYN':@#^E#ʳ(ft+u/w% NgrNI"J%l4prCd!7G.=l|GջO'*^Fg7{O";,s%J_RE;~W%y hhMenq1ʀ 3EOYK٧vh?utʕ-vUG$CФ>:<[_!Hc "X~U:>Pk/Ruώc-:9l9:n$nP\LXku&^ktZx$ez=GEBEl3O_B+wߠ|Kw=͇Ą^nL0Wn4Uu.k_7a$\ M]~~-ZkU>K9kK7$m˷{cu'Ax"+%Z9"]3h|*rp@x]NGhpq#Ǧ&Ppb Yuf3#pձ⹁lHwS uNE@t~z?0ǑC}n襎<?(9:m(.iHjX^:*kT4Vd4żiYx ~nUqyvWiv !;_$ )^MT{ɪY!>#Eq{mko^4w+;\4{vu1M6\K-wH{F4-XǶw{(tkZAk^ѻ­y[2HEkG [4Bb0Ggp~f4M^XnIL;?'tv>L2@Q<*KsLtNs!0ORum;K5IJ? HLV'\O^} L [g}4L|X Hv!f3jILv?H=*I R`AWt uE&AKI$#aURIUBҤIDH$II(IJI$LIJI$'I$I$ҤS$$I&I$I9M%IHH$I%Q I:`S%0I$|HjIJI$I$&H$$I h JI$`IJI$ΉI%)$II*MIJI$ApEDI RI$'I$)$L2I)I$p<$pI((I%)$JS'I%)$LRIJI$N$I:d$KC>߁Y8ʴ:?wVl10eݬ ;I$3.I/~ 5iu_ϛIC7S5:fN3.I$&NI&)$JRI$I$%)$N8I%)$I$I)I$I$IJI$I%)$I$$I2I$$II$I$ EJI$*|GtxE;2t9)ƲI$$E I$IL$I(HJEJN:Q&@ID䨒$IP*ED$IdM+I&))%I$BaIRI$t$RI:G$$I2I)I$pTJPBI$S nJJRI$5G&TI;S&Q I'))I$yI$JRI$U% $I;J#wE)$LTJ\$Iּ1VyUcX l O%|[-F-ӤH0$.vS{7&Bj|{O4rd}mJpkZcp1%%N')͐M1۩'oY ]N/ҽ]w/7&YNa r.7[)0:WwqéAwMMe#u ; ځsH!??QX@[ky<&O>zۺeͭ.#w>M[؉7婲, l0cF3g?ԔiO::(Ώo~'cXIq'wR-ʽ}4sy?/8MWOemܒu?_78lYJSkF2\ OhIg@[UmsO7ܜ ;44F%U{Pݑk\5}"3%\0Z*)Aռ-' 4/o})zl{KjOrG/88O, :UmY˙~6NK<\FѲśî61(1 ŭkMFH;\GdjnfC7d'5ǽγ.'iۛ?I uƆ6ܳ" Ok0S(!ې@{kcFGe팗[tl}Wj 4y(ٗUGi29$c h)ge].⧼H>?C#rժhe5Oz-z+ppPɾ0|V]Y[kH-#ZwzO.%>些i)M۫pZh@=|>Nmdv/_]#A ?n_2;kѩr8pThYlvn0#lxv!1r;#R*a}J/7CgJ %$~\?HC#8Rn Qw^Oh3*u`@>jvXڴ{頚Mki>m7(Y"~>_ȵ6|ۯeVnЏwb?QmG1UXNVFl'nߤ$68n‹|r;ޡl駸q!C@$yԽFr^Y zQv-aGV%*{ kR'Oo279??LwAGǢsDcs,!JfZ9v A[TŰN'F{ Chwh/z[68GAI_OJ5tKN~UEߤC?nov-]{Gl=^?7j?+z*\?qH⑳oy#AfSlq3{;DvKm`|U0c_qh{ ߤW{2[,!<ڒ=$O'Hd<Pl&u$ײf nSk}݈Լ3$ۭf~,;g $<#HX8p>>z'~HK?ct?DnMNn̘~^nAZ)ƉCU#J#@B~!X؝6ӲV=;`Oۖ{~h۪0stZC4pkZP,^4e$6e;ml MMx"t#vɷϩ).w;aB$5S_Ubnv8$;o/ 1vMm'c?y"`Ap`LYEֱŻ\\sL&(:S.xO\WV 'H-DPNhPKɂ C͎y d17cl˞6^?4QG*%H'uѠ!<1Xmm"·W {\֍<ݍ ->vIII'>|$@sLqɨ??W6|T]"ֽ t 2M]#%V(wizF|0DV5p&`5y+,<>{/V}:ń8Ju:)HWȏ6P갯}'>8_mGn$0ZǭfzHl> !ж8>m3R]$wwS=I"GϗO}ͩ<^ih?ɱzԒ~, v}f5 0Ggʔ[ts[|wnvgwoձKҹML2E&\/XFϒfb[O?=gY h~k:pK@@rJ!?<KOTIS2,c(5㺆u+1۵2UMZHןc!OP>eke{~e-; Mך*Rx0#hZkD̾v ^nAkZAy*]>g]_{ k&ø;nmB\UX(9y΃7W|uW[q=OcʷUxYu7o!$6i)ccm%80I2nޘ3<ޞ뇭y-~(}]8bo;NzuX:?K~9h@_^V am2>ȴPڄ.liuUFeЬ`uYӺh[Tu oqgz53tSnE7t7<ĕq88R78BIQW=מIV2n{}tXԎU\MOE\SQ]:&22h[Y_찇%x£h[K%]"]!3Z9 (5:J";,<'b<*p򫼲CV N NQ mAjѐ-P&U9f?Ԥ;oX5=ո=s:0~Y.:j\PsCXoh7%}/,v0$fk O١vR`n <  AY]b#!Tq~>h D_-ϖGУtP{?T[Da"u@ r񪽖W[DA!RF8{iUqK1)ZuAُMܑT<;N!9E@Xu=McA/!PC{o&Tr5?AcYNF&VqUEwa4%#wJ6y}7#ȯݸ?(ߒvUupU7UNKw9ihveF}v>UpBoIkʫ `wU~#e[p`1U.[Ӝ,ۻA6:$A~\n-ouScnjk҉̖^Cf}Y{w̌z )F2#CSCS4:[>okGϲq.CwԛUr=R ^G-,nE?IK<}֧rod;A gxQq~MSOoVv>ZKrɩ8;ҽHT ϺPel9}J'K[XOw&5q%'׎~5J K?Y0x Pȷoo!&[iҚ(\\wg]'..Re'm-4;$$_<s%X>Shmde8]U^zyMӺqiXQuޠ}c_Nf7m WWcjk f抿F^Pʹ~0äʍG sZyYN%; Ƽ\uƆ_p2lHjK0$X8! ?8x,^B3޳hsZ9$$z#LuTK~ ӎJӳVZzv90ӹ }ZZ:$w5u&a`b}Tr1uMqEĴrM.={+ @ 9Z[_PAJ=BA<*=K74}8u*I$y(bƴ{ m$ +^iz8y+be#:}+uEUu}.7vr=>'Ca#mC nmr}A<(YOڬS{n>aZ8cZjwzϑnԚru{%U}8>9DRWG a>V8Å >L"c.lee^ o+ 'WN}k=ջ:wRkKnlYYG)o7N9lqa$?Eڧe֐+??]V]- <|9btiwI.Cp KF9Q7v|ocPKYsDŽvyVW?kcG\7ܟ}7A{{U`6`4sSw9cwQd <Ïv純\7 5o՚ŶbG%ߛT݌it_۪x_ F[_ƪ6Qu[!WC\ o_sh"O[۽nv{ +ԟEV P z32wa Oe2M7 W߳2Ef+n9'W ?O9'@?뿞(v@3wc}j͸e $ DiX?Ի )=!M3>'T*쑮 <~E6GDruݞ8?ߣx;o) pIJ/.arYV9A򀬸A_~3\7> ;KGoyCǹ<O=?1%1kAwtZ/58,2?'u-:s60r (-nsKd1 dL)$H)"RI$&BJRI$ڙ%)$O2e$I.Zhx)!I$cJ '8I$nS7!!jI''Nu ˤ"I"t:)7*RI$Tcrd*RI$wQ:pH$)$N\ Y6"^Gp%H]$;I$HU4{O蔺IDN5 I$I:dI$ RI$$JRI$)% RI$& $$IJ}R))I$A:dJRI$"%"I&H&NI%@&8))I$u$%)$LI.RBI$$$IdRI$") $I)5E8I I$fgp5 .$I$I)I$%$BI$I%)$I$E%)$I$$$II2JRI$$I$:dI H$KG>ߚϿXUog㿬*?,?d;/GgpI$I%QtI־ 5iu_ϛIC7S5:fԒN3.I' S'%)$LBIdI$Н$I$I%)$JRI$I:d$$I$I)I$I'IJI$I$%)$I$IJI$I$RI$vQI$$Zmpp'*%6YK$I$II$&T72PܒNJ"I&*ꜨI1=JrI$dIa\I$IRRI$p RI$Ij JRI$%@'g%hcO9ovѿJzuEZP7GN;}D~hMQz{<ʱvb@ #`㟏 x!8p֐B90sğm9"L?9[R-m^\tZ_u2? 4wc1i(~5o#:g+Wk7~Trۭaɼh\>\)ӣl4m-'v-v5Ecv7mxTD7ǸUks A5ŗm࿞Q]mM J9;^ߢR06wҒRZhtV]ftjua;ߜvVwKպ͎'A J--Z#PRWUT Du3wZg'-hpGCp<k꣺}9^̫F o?碋BK5w)Z[MՁĭXD?UWC64OzlPw'J"մy)Rά?pc8t0 $edwvo];S>..n`8 d6֏.N0ѮD's}Yjʵ }ewo#ъGs4j%/ 'OA3tHt<(6FXw3k\:j0;==h"ǤE#^|BaA>|So>\$#V)Qu~%?܈EYڕ,{j~t*;r) Z;r S<0!e0Hy$AUz_3;Awi5:@/ټ=%.|TCvxRqq'/TzZ7e)l7zCO3m}U_Tc EoyB>')#OO"?͹MOy{ͳtAu^o3Vy aDjaQφ;ZX~EDС_n?~ȥ>uvV ÷!i) |hD%7YV۷f-o%یPLvHh?Moqxg)|6-EO˔塿Lǐ7#Ϻ җzɏ͕ۊD;1i0Տ?q1ʏn$`Oy|L0 (mk )OUanݴ{6Ok+jȟa C ñsv]Gg[U$"M we>Y~?}e~E%; # Xl9i]]q^8strIfp*/{ӟs5:,s4Ž]N4Xĸ>)cYr.Zq in?Gz'm;kuRC*7tIJfNô$vL,k~g"T}wjdz53#aӭ\k*d}#ݣ)A—;d"ߦ~C{%;{N?۽&hVq-Qۄw^cխ%S0 M%R w->0m>}⌏1gyC\ӌ0-=_qooOcRMVxءqdbJMl?KDmD^6noq[llQ~;YhoSSm3)Us.npC«#ᣒKOߤ!EÄ4xM~/mvL 1[k*cGT]fUW7<;p=Z:_g;S&U۵%$vs 1 ?I]fH|*Ŷ4yj#Lf}1%-~qN}'Pcwhkku ݃M~>2n5׳0;Ը,wo1ZITk$?Nkh0ܘN,÷!Π~?~9'}hx=p]I݊:R_On3}k<|0Q5zZ'r_voV{9s<ǽ3 ÷%&OF I5{]X5 ʛw0t#J 8 q0{Ljk+mk:nږ̋~mgITs<~m2?A$L>M,9$zmg:1Cehq*SIn~ٚa,!?e  )@`v O<]{zV6M-e81pKojGQ%S8tuSHto%ʮpqm7OuW׭?uo/. %58@Znue7h?]cO3%;ҟ$EpK֣>G?> ~=ҊB{L÷u?)H|vQveGAw$}I:loz66jkjp{*}M(a:'< k=뤔&.J[>g) ,ҥ薉=TU1MnkRiѿv٣F+`$/>Ii'XL+B\ [kVx~C=oᐁtx|4=#kJӢfE;-M:hrPzN3\}A$k̈́T;4;qcΓGg?*OqDve>ѡh_L׿I[ {胪(X&㱿G65t[|̻3,Mnuu'1pLI[ lgfXԘ ,}m|w(XdX5քz8֍%Svevّ)+/vLŃ\U-@纍-A]OX V/Ge rJvtx9+##.̧nxāV~^'DSfAa଱`Zy}p4zxs'YdĭZzf>{# DNure{-1XĬn~Iĭ:{bH=t4lHr7%|H/qU{\c0 lhutec}ʍ}~Kt[k*5 KoNa4JX|tUcutOP 'XjIws]sugU߄uRk0Yt Y˱z7/YAlv bjF[-ZWQWR}qbYCvLj)8!jjm-Vj¯sx)XݥSkL*};%q2cgk ;V˴p[Kz6ik;%Ӫt/U`mB[6wQ ~ O?nFBaZnZ7[V~T\G,3p庨7~S}֟Ul̏+C ]gqSFb`I\UqomROD3\*mk5q*O{1O%RwU_+Kq̏5l_oTղ1^ py@-EGո6*E伹tg: Y> t9Mmm_Qtjh>J"kw^77-yvT u[uF̆7RQ:H=ʰF4;cV^5n+}yFT7ZrQ&/uX'hZAPp=QtTe(#f[L2,pvVo]f@Y}nXY`OMp$ ˝H}:Ѵ"^Hⓛos~pÁoXӨg!.F+}=yŸ Tn$}jQ:Xk}&cڭ 2EƷ`=~ǴhO};R?f< ױ;E/Ia蹥BfFFٹOnZy4ϵ@]iU0oc޽^ *Eԩf+U;sBV7sHXn³-- WoyaLaZɲiTԓݺ,Z*s*[C _-vǙiLXgeau;sZz&jfa1! W_x jX-#N)p3%hwkI_(>XKNJi`˫MvIJ ն6M4&t@uC`v~*n%`è 9=~` 6nn'l}r3]u:LjEZ_eLC@hk(mu2K$.ς&kR{O|| %Ci7BE9z-e]qV?V/#J[=ݪ]cEd5I7n?E;gt 0I#;q+kta7׼ߑ-%>%"%B~A:h#Y_> vP} c nc \7eo7=kUh$N 5֫*w}GJ;,VȢޝpG4Os 8=X }_tcp$ɓ,m͑: [j4%c;V}zaj :v[z ~ct?շ]0 i>,rw0QW_麱ecG m̯y w^m^\'P?w޺e×?lk &do.B+jsTf#k;?E1q\?4h`E蛉7Pzn5A_ &ZO?  ϗ$>H0ݮA_<aEY疔ܼ6K#"ۓ[4'IE}=P?1Ts)4NHOȫL$6ښD?8s> T˷n`WVgklG"6kb6a#|bH\ǻvcMZvuI7=nKf>g/ 1}ϼ5Gbf~I,m={KkG\hi3Qy=9ix;KOw{5c n-<v kwV?]+d:`KH:DX9s nۅbrI D!%)$OLH$$I5D$IOI''RO<"I1*ADTI/4J $$I1I)$NL!HܩI$DA(()$MRʁB) I$BU,Tn H K$ g*!Xxiu2I$٣I> ǂ-!VrGeI$)%IRI$I$I&)$S$$IL%)$I2t%)$I:IRI$I)I%)$I"a$JRI$tDŽIEIEJ`$$IIE*I$ AJI$S$$$I2$IBI$I$IBI$ڙ;RRI$Q‹@Q %I$I%J*I$JRI$)$LtRI$$%)$M)'I%)$Lt)I$MNI$LtBI$IJI$H}q?htY8ʭ?baY$w ITf]$_~ 5iu_ϛIC7S5:fI*ˤI% IJI$L$I$ËO}FqhdFXNq3!y :ïf^{'v5w4$2Ecm|Lk|J1p굠5\g}\xfp׍yHhYA(QDpCx߂kK]"O[Ug}mO_hNOugaum\JJ\5V#c %ߑ;'A@^vUڰoFo5Hůn'sTd`y?J\]~qC0N8E%pq9Mḟo0vu#&SEP" q.*'RBVldJV?W Rm{0<+MX6IT~%fbe4~Di=QǴ4⮤ٻ$JFeُ5.#&eqΤT1۸{RC[,aNJգEm?rڸ!DC*fjp7=yIJ 8ۧ.{\;mtqVa8wh?$Lh!Dw*̾ƸOs[έUwb9C,XύJ[C7DiC~!DjA'> :L-esx)YƵԈRU$bD:xjrdhn? 24<c0&[O{k2<LMѿTZ7VC얒&GSIs结کjǭgˏIfNqiS>(NAQ1KyՌ|/uj5WG0|;:{wMqM%k/F]Dws1`#eGb4H_="Vps+gŽZIKc?E9N궍;A4(YC-^㉰ǀԔ)5 dkaP=ݽb=F kǎZy #?MZIԟ$^_?)5x!/e?T]cu?Rc:Z_Vjǥp|@e2 Ѯ\Z{6;,k Buv9ŦexUrk[%b4=ȵYejT2pye7~y"wq%y6$m. U:kP2$jI(JI$cW\zDjH'D-ln~ 0ߐW. }o})hFX#x=6O%H6ߗwK2׸vp;w+cz:V@s9h\@fu Y6H9$mMa9,V0$V(`q| >tef@]Vr]uSw"]],I'v>]x?K[{5f0F%tj.< fF6UGqȐ6s 2,x슒6y UvVc?}ßSI J&ƳOYg}?=|}(^l|FQ\~|\xh))jMJ}(Ya~FquPqf"y eOү*XɶwErk~@weƧzyCcAI 1ePz=&Kj~ẽG\g<'G6DИÄZUCW@}_I;3F_"zZ'r$9kQ̮ny*Ѥi<<2?^.l˻F0T<\w;)Ճ]g{?y֤)h8!ɝqpoU ȰYHҹDR7XrnF; ~,nImw7iqS8u 1ݰq{Vw  n?p}A7"F}O[}XZ kw': zxwos*F?t)Ϊ{^9krArId-n|(nz{*sG3YJ$$~(Ԯ$x?nIVbȧpCLjWȯMFP }6w?uQ]GyRR4c0*{Y_8~h&}~_"sX6d$mmCu4xWvoA~rJV0ٿ%'d݀zF$zMgO,UnF=3-,mnli1 v-oկ HVA>SIhRe/k[lkc-*4\ݯ`$-8@?N7g7jz2k[tF/S\6$]D> fq;_ݮУߍ^@>k[JÇlIK3^GQN׹–Y+@y㴛g{@06NthIWقdcY.G> Ǘ&9ӷ?p=C%ޡ r渖k +^6_V6P:< |uAkf`h̍r#Cȭcô$2UK'2xC*Uje]aHv vXnE=jw~io˧W5>P`>jLӖ<Ҋ%τަN>Uߥ#S]AwQͪ9i*WUvpIJ]v‹}!wr$x27!%܋CbsG;ͳ~9Ϣ\"M(F nOݙw@[w#bSv%ZΠޝ?bIF+s%?؏3Ps%k|ժ!5Wtlwx#h_c#ݔVƱX G% {}CԤޞx ׿(YCG#$Ԭl0su rx[ E?pyF,w$lVd 9^> }(WǸpᣂ bf}}lo3V(ɯ!pwIa[W:xjath XBi:9\fIj~3F;9EV4gk6%JWbHH*Wt?)r~&7p'6W@w[;2n?q:wkwd^0!?Bo8"qĠW(%]%#Pl#nm-d;yfVVC!'RR<̩Ǔ*ȟN+nkM?ȹ6<9Ѭ)u|3p<8+eV2w}g$E6+%;J vUC4~g6EwA-wSoR=Fpۋ@ې+pZJMӉ9T}c<%Rط6}3~ ]ULl@,nU5ڎAЫ/T~J8C>-xO-˘G\noK*xBϫyE߫O\}#׺e,-une^DV?*{0oc[Zc={K|\j^2u׮#3l9UHE_^lkk\ gJč Ğߣ4*xͪ}򼊼m5'[?W:ݥ6)oqY:\|JT;+X&-aN]LuԨ<\"pƣ&l.<;˿g6=H ,x3,="ppҹ~C$R %,n۾cwÄەm 8[XF{zF5@c{BcJ:hICQٯuOM5oD( <K=a*7Us̈́ekz;ŠoopMf%GȨ6ۤxo>tևG#Dj_mC#v_js4y2YN>A5aC7::n7u\m|T_\wJѱm~&l:GO7Ɛf/Qi}'keqҳ ' Gpudx`,%!XchP1Pߍugi|=tQǯ<5V1)ȣRFs=8\NNlc}=9 r6I\ǿ#T|[;鼸j K]}OG$HaҲ+x*5Nōd/%u+/x]ЮfN,w!]_gi/"&o}V2$!d0P2-ugdz9M= h"+s\;Tt)&R<77i+'iu;~A.%^iee;nC ;~SMn {\x{5i+]pFQ)t Q+!aKIR1S`PM!WWd=ˍ^Cx0?S}$KCv䅜hZ\nSq4 ^9ʸDL+t3԰:RPԦM,OtEG)m:Psن􈟂sߎSkGd7v5ۧ+=O5'?|:d\zǨ\uL+F GӳE-x.;q[)S|W6#:w7~ ж.m" *5o_㋄8oӏgnN<ɦPc9iKt|0T7Id|?$vf8A#lk+Z64~IeYGv? +kU]K?kC;!֤m*^xbӵ*5U'+9&K჉CP-cF̍ $hP={ec6͕ܨtqMnXo:Ziu o%t=7H[6mU4x 2ˉ<,ab\MӲpP[Y+J!p(yGΥ~՞o*=S ޻5zhװ~I@s;Pi Kؙ5}܂3l{j v b?jcα$aoSݨ jmIVȞPkP,N >Z=S8 w .:nv+lm%*PF7cKHUpŎ!6ZJ5,oBmk\hc:HyT$5T%;\}<X̫Yۋ};JS@!W~ ՝Béna=Ι78QkzcJ;' l_Xx[7čRW^ie 2Z ?.^5=I lv#J_kz9_I_؁f?~!d6y "׳K!9`+n@N.mA%:sR~ w)_6zvZ O4{I_Ys8~Vsm[#֥KiRHgE<][ YF\D+5-RcE~}647Pp_X戂[;Y;wjټ?8YM ]V:Zk-:'_q@tAf\h0.hoᯙJH<[:aŶ\d * =O;i9#eZNu11cL#A-PHV`r*lWxˋ֎U5eEXkH栺T?E}CA>{q`q6] fEv+] !>)GB8[0G]u,ڗuywe$R$6:.n揚#UmZpn\G1È#O_1kUs]tkzVm?GG :,0q.wloaneuVh8>!T/7khLjOFK 5ڻh5Odoڈgn?娱i#iU1S7t1$1e[u&HJaL^ntNv9`!&%ӫOjm%}]%3䣾~1{8QDK>zKx?hͦbɭd5w 3*Biy!5S'wXr=W#iu˘ښ= ٳݣXێeU$;eY-srI @ ceF1Rs4I6l.Oamg]Góvx`_*J@8FTTt?dzjlѺQE?M,dhѠh[1K"c$oUQI:ǗȼסGj,f\@)ѴqL8i<7{5A}5k6᝹Bkcs?16IߙK<$OCŀbݭZ;O;4ppix!W=޵'ӷg(PO,?ͻIa#+?wnsOA#ȩѵs|mpG  p[YCyߘ?vS*v\h6vcKuw7Wޞp89-~?lIi7Vw\7p2 wӛ.li#zl֟qM׌h `Ԟ?r_W7Ume@mxу{YFx1E/:<"d܇ꘊr3mٚQ:Fg@¦7v8@Jiݝ[v5kg]M̱i"J|] KqNC-[b.6c2[` #AG7I5oQ;~Q}nf(e{vR^ݖ;9gA=Br^}[c7$ xV*7S\Xe1ES6:Oš_g;:FmݿWr5L2/v0Pƫ[˽@coUSCmVc _+muBy(_JL]q*sm$en~w=2w)cQT2)ev[@n~n8ی};;wej{ZUԑIX1 M J@CU6O-ۿgMZ =`†Eɺ6 䵟ىv7#Fw֒N ;He`'c\^yާs?ghxtv/?%WnsFu4{=+%CRɩ@g$_鷏 }iWS=ʳU,n?펼+w;JS{ "ƃ>.j>mw~ǎXD8W *ѹ.2Oo0~GvbZO!>3S ;]G*YIVU-ven2{JI,M ˟k T'j+n[nFћ*@5熷W)(czB,cTQp6>My#uFc][v4 -geq9Ofm=GO$4v4ayDDaN|T,qsסo [a F;#)}g;獼7*/LT{>na>ɰzcG%>GBPzWJ̆!p fZA c{~IKS~*Y?λ&x8xu,X8~x;JMv)׈Ei S^k}TgoԤYj2Daoi=-fc!V[w,WV 4w*֞ݵT߰{GWTWqOnRq5`(MdA8+Vk6X|Lݷ/v4,K25g3`o?@J-&OQƹ=7v#e8Aܠiwa<9Vc׮ weѲ6vG]T==;i?ק$eC@#X3ϔ }1 rUx42?2Z!$y?E`HVٟ#Csv#_2a)46}{TF 1ۇf7XTkP(#yj^fQHyWSvTY󆁿p2[vF00 {sc2l[bHSs4=.PΉUκ_isk|OE>.e6#kT2r|Ѩ4;00aƇF$V3G)WS'`)hJF)9?e03I}5fʨlg{]AN; ~?-xu (x3K'J5C}N#\D LARNq~gRoQk̖ua&E~- pBHc[ÁuݛU :IsV}au$ <"6@)V6>F?T߅nkŮg#lVqZǸw<mJhjQDʝoO(7lh㧇d͡Z 09\cFSp|6|}5~NG`Twٯ13pq>}G^]wa$y.7#~dߟe1SpZ`6E*`ko66 0_A;.S4[P{$~fXI;/izRƷZK)pmx-6!|[@Ӹ~(tmm!PUos>e-$aOEAWA)0Ñ;hul(Svim wV Ʒe_brWNwF1ɸ.?eKbV8\ݎ?EKc[|oXkL]5{1֋k3gl?_iƝԓQAm4<1 lwWZIt@$D;<֝v^sOcHs77ƾ[Y4{}FfHݫ>#I5CGG>7Ԫ9Wyj=Bۧ"En98Yvc.,ȏPI?gA94G*aVI6#j=L>!t-R8ջ.ێlVsv>m$߿fvx;O_AFΪvit:@KcK+o-qk<v@MzIq{@w[mU׫2x6Y،1qXBZjݿuO>Bs2IǙ; A̽pM*Iͮm߂۳cLnmMg:U8u8<Zy #nvQlus`ĭD{XCc7$ 4V=ڱqZψ]_O⪝Obub_ScnV Sdy8+\ޱͺбWk3oXX|Z}[gNkd@?5*>cT^\XKPZ۷Ge,s5Sv>fw+~ߒa pi^8oQmPuxo6+ʭ7r>u:iwMKSCk;^GbN'nJ뵺qul_(qt!]oD`tHOc} Uǐ]\O֗쪅dpױg뭓"Gw`ki#hbjW~𺜿N(o%VwNVk?iZ8icY!X*"WGװu>ך-A W%OT`*?9,weT*ͩ?+3cewHQw;ޛ#7ڶ\牊҇`jZv7|B.b{Jѭiis.4chΖ{'Z.ݧȈJCX :јǷ@+Ϭؕe'U}nG>lT5ϳP:ٮ$}j/ٹE_t cاqcmdۇIQn?8Y5Xi[}!j$ }6^:A`k-q^kve_U~A;OEY2I#ۣo؛oQjG.7[m^NkGJ%}VGFPY<8 cN3-kI<6ج]ڪXh8v!5U0I+ 7w*AG y='nJ@{s YVO6 .(c}ni>%`[Ԭ{ SmU! pGuz"\=qzN%v+U%vPw~u,V;@I&C?X:"9g05?ʩWZ:~;ld>1'I "?(ZwٲR9{kYvM=h@w\PA jz!{k#ԁ01edT?7סC얾W4,[m -1E-%0ѩ->hmPvܣj{{mL/$*MEP5\PYeEx.lg](KKutժ/ƵHoҔҙ́`LΌrkZ߁*thxFaB]v"N,8TX+fʅDZi,rv⺧;B9Z':?WV+Ɖ{Cu~~( ppj I#{>\?A#Ѵi?JޛoY[Gzֲ~S` ׊9lDw|0pR.HGQsf.R{R׭6}d oMeP>2Վ䅟EǰXU܌f|n>wCK;78~E"D,z6Oqג:=N}`G㽧sunB(#jV7sH Ed:hj>4  #!huz7U|f+I (Nc}B{{#8 ?3)s!husC5Ph>2QݯdbKxRaZO״!K]k}U|l/Q odIm=q>O[cU':<ʼΕ^h`<+mk]3Ҫ]oO+3!Bt)+mPGe|w i$m8Q] s>eg u+,t+;38Z7[IM$k[MNi6ߡTok5dh}3WEҳHhZw7~L=6U d(]H*gzR`ݶZ\8i\)q᧻GoSy*zsol;{s|o~>7gԹhgS8Ϩí+nU-Vc 1Y>:_z8fs+F49?IC ,sIIUX*H?Sb2,ID}Nh^8WJp^?0!bJny۝a 4(6>$#{9Hip7?MJ1^Z? v MmI)@KNwrrDý79O ~?G;6dm:;w%^`g Oب6YXۙ򖪯Skl'ʰS*!:(RI$$I)I$J5D$IO4$RRI% * Q RI$D)JI'J!185JI$Dhɜ8H$IN*%%)$HBxLy2$I@$)$Hj^!@=ZW'L5dvU)$kP#@Q"b2ςUiU6@:.I(H$$I$2RI$E$JRI$I$I% %)$$I$T%)$LR iIJI$d6)I$)QIJI$Ra$)$HR*!H$IDd RI$dI I$I2tI$$I9)%)$II*A%)$D3Nҙ $HIJ\$I%)$IJI$'L%)$O)I%)$HN$$I$2JRI$N:JRI$I$I$I$$KC<ߚϿXUog㿬*?,?d;/GgpI$I%QtI~ 5iu_ϛIC7S5:f'UI$I$RI$'I%)$L$%)$I$IJI$$I)I$IIJI$N%)$Nd)I$I%.HI KiVkbodܩ$BRTI@{$I&BPR<I% B@?%)$F!UvN΅63lI%)Q.Q.P.S,RI$J*6&I$JdM\I2I&$I$H)I$dF *ZRI$Jt5*I$RO IJI$P5EJI$)' $Iҝ1 )I$p(RI$7t)IJI$NЙ8IJI$&jA$NI$$I' $I&'TRI$`YK Vie\7;/uTV-C+;FREak+}&++G~r }p/OKs hat567\IwґB,{+&w| 4 ?K=.mAr[&k<~nM@>gYB~#w}#8>IY&'j~"=TGkq*N-`UAx%hlqoONSZ;yILI.G#1LhuZtrD`@WY4'/{Ksnc cÂf^Kά{TG?Z^_ O6S~%J@<7Nm1{KIZ,}s5ۆ9qӰVP` 'NtQOOq \$CX~jJ_Gd˜㪙C .2)&kH&J@iIxL ]! ٻA!zfs>_b^uֱ;0Eh[݂ g73Pr{C x)Svݱ¶zIfw(L:׹n׍ ׌Mwr3jmuwqbuz6>}$. &FOe|4LqT v }1K-TlȾ[C[ ӡ-?gW1ݣ~e1OV[_?`Ʋ.0HC8ۇL*`$Gnax(9xW3rYkkxw ;a|p[Y[IV ôRΨX_OditO T*,4eo)Բ5{lt?uT+`]vC8xD5&cÁF:j5{^dPO4;|]2DuVΛKݽ;P uVGv2H>>!c&FݭER&Unsf鳂jbJ;ڔ䷨==^aQ]Si>=}:W5?l멳 h!Υܕuv^xh^Zv3u?$x?_3#쬼iJ5wنM_!ջ#HTݵFyxÔL {Ogxa3ɣF sq*LQQ-Ǯzoh-;@hN, v>w؄Z֒px ,QRŪgQp}>?PvDh}M,v7Uwr Ҍr%lRRދbg1fDwSmoU/mm*ʷ#J}[\wWc}_h A[ fj|3G$0@EU%㫏ZbtN %(-2 `C=>տF΢sMo''$ۓLznr(ٌ1ER q24WYL~;O'tpt}&~*[t9D Stmx<9X1IP!jokϤ?؏Fu;~Y؞.!tUpuԔƇ k#fƷkDh@]]Gi2nP/ɷ0V<]wNopx:|ߧx委h iS[y%wY%[Nn-&UɃ$>l5AKjr]ma3gcՙnC)p%,f0:=4$+.J۟O)Y+MpxӸS9dKvsGMI:)!D?ZTۡ鵟H sݨX, zXXͶ_h/y.?9ؔ35M;uuZ%iuJ6=k̀D{8+VUaec7Ov=52ZF`?98Y)nvվMMq6w?DRhr+Mn˺Ibl?EDsϤ#4"nQ{v4*)IL  $UF՟vg 5;⍙P6?p?bٓ)oHQ8~k9H"XwHVcs8sY[67޳2dV'p1h,c3"N ( >G,q3#[3TX&O UhB>M?~jjٍhJ;}_IMbLIRm$t%Jlo$%꟢pLh$~і#S)n< ӣ,-)ՙ]4t))Aaj|O3qj5h| FQNJI,KS(S/nZ<FRmIJ;/Cҷ'[ݱB%`p&mN<<Ԅ3>%*w=^6H=]OSkE`Qɗ~%,8P5'5򝴹.ju5ݤ4٘ǟT-/c\=YhW 3m^*"1[N`=BZwCnCUsV$|UȓxC.6}"9< AQVvyUήߣρZSБlp&؋ klj@~PKWvM26w̤[QZ`H`jV6&O$ýĽ'm'D0>a9&ڇc OE 8ȏ j{!zt7$Յm{V Nl}ŀMIWxc{ONDie,Ww%"IK`gi*Q±]uQǿ~T_IJ8>xh./MD\7޹BВQ'"-xx VXڇu66Rㄵ@Ip{|~R]+&HAV[q]Yh<Ä.W'#P=6yb^]W*Ρ%*s,ot FxpF]ax(je/ mC:*7o5Go5v_e7+]yM+>t+/$x56t:|\S[&>ոηS{p;rSGEնijzTx>X{<[~لk2ZmLy|{~ypc--w,,uc8Q[Ӭ 2ƿHRjNPsAqEt'}ߎv |XܖWBs9߷~?J̫Kg@ߡV62 ITGDua31Xy]+q@Guɯ-dTo)Rq oөݫPK'#կhyӵÂoڊcRmw8==Xb :Oձf;ѫ;woTd<]ei7kGBnsdtҤ[oB7%yj:}ev?-Xiq՟rاcZbG&ԯ5Eblp[iYoEE3Ivi3ĽTkM5wSmKW9( YwcJ*Fh [~Bp=VMF {wDǨG?ն<JӲP}Lq3INf`6`e %Y݄{VG;!+PuGOx.oVcg4K[m{*܇tz^7R4U_+wUЌ}M eCV.{s]> t+ AnF>ܯmwyiRz-7 w]rK?xvB:n\~\ʷ8?lo"mv?Aݝf"\Wj_ݿUiߑC* >)C~nӹ}B~qnCA>״YUzpyyvY&7షҭr#zs>Վ[QAW~ 3+g2Ȭ<(V0߱V6S7 ԺZ!!k5HhuJ_W7J)Y)<+ uO&/K~<wNeچ?JzQq۶<~. brNN2u?yD?^NK]b[_ww?iRx6l8wJmړܮj}|_Ze$w=H?z_P s,`SD]c,a`ž1*U7@6Ɛ,lx7PwE}Ж򮼰8`QB$GݽL7ଊzSِX}Ztwvd&M6[_[n><{@TpGc-k:n-%73D5Ei׸Өo륪p[s"GR92 ]N[~ in֧  *ưlkuFY?1V<$}]z.A?F9[i=74l[W+ ?U̳}O`lw(OHcg*Z󹤃$~WR8U\8?RZinGINlmpYovFQ:d:VC>}`?_BY : KOA}a&yPԪk;ô6,>乤4;fPz]WCmo?߶4R5orJV}I49*3 {5Ix,ȳ=kN~FۧZw4N:]8svWx]'#Y  ;*s;=sJxwԈEq[>.?R.fJckvxpBYYo)2ݝ[PisLH=T鞛9lUXF?nD+sDVNv[C yˑ_*UM8-%5KS qVRJsѵzu0wJqOH2H7s!r}5L0[廀:98 f=TidtohX;rG.Z$r(n;h{icu^3ҧMAy{MDg]k*@ ǼN_haQ'9Wp 勧M2 $I%.R(!I$pnJRI$NSJRI$鼒N RI$ H$TIJR N<TI"|#DH$I)sb%%)$M M$I)ܤI&pj]\UA V2AIUX *Ђ۲Gr.:Hl|4U%Zf:)$Pr $I$I)I$I$$$I铍RRI$$$$I%)BI)I$bR $I2IJJRI$TJpI2GPS"$I' N JRI$% 5iu_ϛIC7S5:fITf]$I2I$$IH$I%)r$I$I$$INJRI$dB()$PIDrII4I NEP%E$ԩ$ShOǘ`){H४JI%6rت R)$$G8$1k@s| an*I$W/*I$E &*loH4)QUI$? +T J|IHRI$(T=W O?xJI$n))w$I;O?x)$Mio]FqRI$7x'5kr^O%8I$[}@eʗ`$H!WI")Co\#a I$tRH^VIQ !7$HCzXRI%# 2rVI$M!% I$IlOiI$✕ɛ)$Rܖ9I*E$D mPREIZ Uz 82QI$:"ae[@J8)Hv4Dˣ o-]m-kp!rxNpbs};:!FE/cF)KVZ{q_R}56M.x<{=(sHku{[oz^C?Bc|bޡQ>K cxiz)na B.q;1O1Ldnv~TqKsgXi.5C }֏MEKSN"@{jh(n^JV9qú_f={j++c mCs'eÀ8jJd 3P/$KQ6x*?MϤ]X=tW) ޛuAޢxr\k]O,Ki4A?E7H[4 |v,JLmoGFw?9yFʪ[e[ 櫍į]y=ݪmXD?+B}mxkPLY|s/Q݌$k/ H![ _`.[bc~>3xxQNMgORKiҰam?U$+'ʖƿ;irNnl9!Ghd&tisUq%75T:5Q*\,=-` PX|;Ĺ;%iuVA귳f|UHk mȸ䉭G#줔%F;0h|IIG/ZlV^KpG??(ې^J~ҎP6ׅ\\ߒB4-`*%vDep7aTlt̩c̺5qCHku;f~kj|$D@UBC4G-æK` } dӭ/J#o+2ޛ݇ILZDR}6 [[sxەn9:EF.FS?5RDKN_,pp [I)x"SPO>:˛OYYY q 4e!Lk:".c$IW{`tRs7)Mknu]?FᆝM_DY Qے6O X)ßQ5N%:"UeCso;ZJ>$N>92|- i/ 7c݉,-h`<>.khEH$fM'-Ή#>JOq.>%6atioE  .-w?FR8 0ޢ@7FHȵgEW7aON lmLo XyWv?7^GPi :$&_JOt1G~r wAoi*) 6ϥ>#' < ߘݱ?tߔC/i$Վ;$Ȅfx)1?\eU3ᣁf\d-wP6YQ8nH`߾5>Ǟ I1.xyUNE71;܏oNFG* 6X>Uog׫ ɭsFNF^G#1D*qogGʹK#X!ppCT{$H9U$iϑNJjQѹ @?v|V[Xi0Q)# A}j#Gײѿ8\N.?b[KK!ʪ~WCӯ=.Jd@aNl4-kDCKr dž\U SusZ./ZD㫊NrJd_E /lCf;ԠoRv;N݇TNkqt(#L-K5͑-;L,p$lwcҶhiaFϮ'o~zJQdQ:yFs?/򷓒q/?9*̗o҉ut;-sRߠfK{w"V>Mu>)\=t(- ȷ#Lv?1iݐg~48 )a=S>%>ޡzϡ"ז:O{U\ŀ|Q3eq+Nv%-@Q4'hP bqFN<g ~/͇D5{N6GRRڏ%-!`:?H|E"9Nj|}SM?1=Xa{\[nV?xx稳:9~bJ_c[> h<ט$^/:y+6^چ m<]G 5ޥ}'F d7C6΍L|f^4XF,VKZ&8?jԠcX|0+Ei@ $ 6U?V7裳#x#Yӄh`6ϤxߠSzm~@&v/"m #kxhTEHzM .hO)Z`oI ƃN<4(e]{_?{&pmmOE{>ݶx𳛹{;6?kJO'HmoUșF:C>)d0 }٥M/>_G:9H|i_?mjlnXq̩z-LI<˭u?u5^0mV hbED6CZ8T2(c-w7BʧWQ#6Kj eg@n6^Oٟ.6{gϺ|n yŃ$2=XW`CyL״pPKuRv{OAuVz;e?Z8gn<93" 9w?=$Rhi׏47Qa{u^5*m3 IQmaIe}?z,)^% gJڻEHվHFG?g"OOm_DkyW! PM&Uä];K?*Xze_ Ȩֶ!o]m?6Z?9#Wѹ>*`xcSb4-ԩ+fp<&.U QA!%l~w:}l`4gcYKLl͠xE$~ ŇsGС ;JcUzjZ;;Hºh-P;4~;=?¨~ΰDԏ|||״7kpx?-$\8l}8?-?1mX?I-mo&k#QMD=LoT])4Mu`~ֺ1q[ U魇ZOu+t!DDN/L|9j_iu_ϲ7VjITJ}P!1ͰnL>Jf^7@3IxPѫ}\~Mt7`w(mGؕUg>BIc:)!&SfwpW [k Uݹw3HM"d ݑ}EFy}%*u:p6e=$TiOB.NבCuAk4GVkY7]MJi`s^?4ORVwK=F^GuZ^ ZfEUѫ DIx B(NmSf t%Ծfno3_L myJ6Ry(2}jhK% u("gzms1+Emp ȝ{*7KY>6Ƹ跍`KE}E64 5R{̪Bx!u#oAAZc p*J x?%;o!URmoymE6խ.+rq.gjtQd\9kOtww1?gV|!T[Ϧ֍#F̿Mxhۯb*[24ʇ:wAgu|SfGONrn3w 7ӻ%ۿ4j0v47!?90VCYg4Hǒcth<РYnyC y;`Pn r2n~Q*l $IJ 2eEv_[W{ZwH:n[Z3"0#'HA:JIFa& 2NKV, 48y~G^j>ߘvd4?j XG)'_ZHC.UZ5B#Y(9zn[WvU.:yo%[`~%УUv<& tF~^zT }KV( gb;ȹaU%WuhMCu; C izr(i (2쫳;7 7Z+>a8k^E l+l,0Ѻ=C[:+p6a kld,{RX!~11`Pu BG✰Jv㖞4RAqRJ@H"F%tݎKJ]5Ylc R~CYG?}@&78EI97?Q6Ag2H-t'I+SӸ"@acwVKC%&lP5%O >x[y.:1g}}' &wgYӔ@&s@_$v5ÇBԝ ;8}VKh"3!8!!*Em=95gv䙙NH#] O(' nտri\O}U6o>԰`1uWZ֗Ԥ7tN\*/q FLSV݁!W%؇a'Qe_ űXo'y)#>tỵD>As* EI?jmeKLNۛg\5%6u 910sR3UkXNYnhAA%2k p:pR> >ݯ ˱ݔݱ}?-}2G E+y΁-h~cT=1Eŧ}Gk?Bvw4wGξJ.5ISl8_Dǀ@r0E;9D]ͷ9i$ 'ѼjSUgTpkt(䍻mubָHI,_#P)rNߊx0HW_Ӣ6Ńk6VҵRcT=ԹYwcYO qO9(A@R5Y" \7HH" Ki"Js)HI$I)I$A?dD$JA$S )$NEJe5JI$HJI$ɊsbQI$IjJI%)$Q'UJ pI$9G :VֹD()2tʵN1ARuG.;.I(3@c&U UWrI(ЂI&NIJI$JRI%)$Nd)I$dJRI$$"I$\$%)$NI1$IL&<-JRI$0J"RI$I2H)I$tD $$IOmBI$NI$ %I$I]BI$8LD'$$H3q𒊒I$$T$IN$$I$$$I%)$I%\$JRI$B$$I(IJI$I2I)I$I$I-~k>cVGy5ܰm&w AA$UI$> 1iu_ϛIC7S5:fITf]$I$RI$IdI$dI$I%)$L@JbÄImGSPc*)$RI$I(ĴҒ$AIY>RgVITI\grp$JJ5qB$Hi"m "I!$kob *I($!n?b쩬yt@ cѸ{: XAQz2j`!Rw`6\V7vmϊ9xeX `h`sG~Ejna%{u=Ai TUT$Ur V]tEw|]k]Bu ?3 u`Vɝ[aZHP=Ѫ;W a)9pAk.#n*~Enc[ AyNMD9ɫYWL|?Ƕ*poQ3>+6^8@ ?B+ UZ%q1iI` 9ۻ8'!2u'J qYkji{4wUߒh$1Z _bJci@IG*BDvC}WwW9t`9ہTe+2>,ls'h` hE=9uGDe{5>ߔ6_~).?#Wԩc(AkC<`#H[D#{Տ=?OԀ,T:Fpw"NyqIӟ%Mp1:x"7)nk$y{gثQfDӠ=~NEfEv}D,  )f\Tz8OTۄB^S=ՓYZ`[CHsm[BK{GGvSj{[)4 Iq5shhacFG4zk.>sE?4LD-{(C9hGuskgஆdJh>$!׀Ӯō^7تƛ}{?ѻE\A7;*iØ# Ɖ >>]y7GZ~PXhLJ 'ߴrL;p׏eNag;{ n44}/eRJIΎ%5 Vk<PKzem;7  7: ~m=\栠>(ezsm>x\U٠~*lhQtI-s/ !FvN"7FZ:j8#G>:x~FyуJ)ӂVmw.IIŜwz;kۭ?>gZHc|IY'_C?tE?T'vwz]PV6 wZUߑu9ơ;;#+BJfK5w&K6F{6h?5&Z>st-Kݷӳќs{?ooi_m!d`z&}JzmpߣA`6<οb|RѴQ[kXGcHPn]fXӵ{lmxI݉:CwX<zaj:C pB=B_TpxhAّϥ_pZ_IKۜ]TL)1Dzw(YY4IІ55 ΰ-HkFkfky?'ɑgb"=+c}]~7 =/S5AVs=K7A?IReO;[kN>+.\~uzm+̓΃GQQ>=D=Eͻ_*lΏvΪ5ٹ9櫜3NgI% Gm~D]X7x`U.ܓ ó!s&;ql>?EA%0 ylOP4%pޖ^vG%anʫg=9g G\C]8hұGT֎%-$6HP4Eb<8e>cR̲voSRe~܆;67n{="zei@wj(ޝCZZ.NwHMgyI ՐP-eOmLp G?ڀ~,B6?>V#cՑtxGC|{)Yߧw5}z«NS-wYgCV}5;+mlxWb?MWFD-#VQžYPu&DnϿy0vX`Cx/p?eb-85\f㠔2=#C'BsT 'U~'3DCz}[]n/[g睱w1%'s}ò^Ak'{[}j Q`^4owޣ^=?Ȱh?Zښoǯ!-U+U'sG'6sF*%ڻR,2UoN76}5ݏ?77lۿω 2jw?յ%'7:G^ſ."XC( f햃S?ԳbmBK\gmSpȡ%8 ۴n(vnOuCL q_z%簹 l0C?~rjMO';i!+0.tt 6N_d]ȩ ?muWIw;K*2}<}x7WYIIf@ &7}-+sR[8,c5ߤt}O*σ{oWOBZ{=+U$cGʤsE:ϤgEeҠdV{ȰOc?nnV"<VƼӡS\ ?ѿ Tl}!8=B85l ~?}Mk?Vs p5Y, JI\k3 պ%?({\ۙ'yf;%1MU\a[1Ð>\l&86f]-A)7ZtЄ^|J/7]BH%i d]~WSfAl1\q 0riۊP?WRϦu :7\|̴ˎ)%qRkQsw s*QoP!gÿm5x8:]s҄$RF9q=59 ;P7h{*Wq?qKkmm)]C/mhpd,1XR:7&i>*,qaRZ~uf3GnϦkN'6綗 SDHHIzӝXw.TEEugpoFѨimʪ=Pd]EM~-яU1mƫ2vΣ$f9?=?D:$Wo!A5I/f؍m!ʮ@ rv?OD,&?yݿI^LRD7\9IyGÈIYkցYK7!B< fw-2)}X.gߠZr@v]w$:yMvpKթȑ5U+6wFa#[FG>=T[[T!6NJWkg>H 8tS:oP<BlȱiӍ]"*hh X!ĔLDeD(W[߫GHye{6~k?ցlA\ H q{kWjh vITGw~I"<=F  5=aݔ7dY?^~(19&wNmgv3NZ%&^Li+1sjo;?V'{Tj8ADmxDm⡴K;\Ǹt0zQXƭѐz6iS+-h6>n<Ԩdzk91m@kZ;xi;>w&H:UXЪ]}ߣr9Blxh)ߞnN Gմ>ͣwot4U;ieL4pCnAc<迆E$'@9%R+`ӎ^4c–gpxT͐=4 $O(}i'ch?coO NaQ?O]Q{p?b*aFjܞQN[맇or@;[#01ޕCԸhZTs s1NWjB6gэu%kG,0`- >|fk;-1j-/[Hg+XkO<%+!^Z Pma;#V 4GAkO'Qbowö67SC;F?))ةw?$uoN8Ku-WW g#tsĭ{(a}5Tʸ]` k?bٻ$v?Dĵ[I.t%NOd8C4o!]ںkbZFR`IwTݙfIٍoYR65w'aRGb{NqoQwF8 yu:*cه?Hn1t?(e3w'mx|9L=At=A;2+zvvG!smA,m=DdMډnG&4CsavG=<0sILaIڇ;|Pk,mG.[ 9J/QޮT=ݛ) \ƙ(hq 1C]=!caIS]] cxw?Up1ueqP_3\`\)WEX ] Vc\\6jeqZ8Ֆ #B?f׍2bPU2$3\PAT@d+ԭ>(*5i?M3x"q}鉕 zsEYp?̥@`kwkށv ?7n~v֤|L5JAotհZ A>Y;Yslj~#Z0;)DVZĔ0 |`gCLӻ@{(H67%u@6;?\FmbuI;-^%25>*0;'b<]Y#E*,Cco$ӈ݉)pcTɴ<uO^ 0jZ_SesGG~{Dm/V[pdoòH\ Netٿ4Cg]ȼ~wR! 9^ڻ7bIvH~hi?j)k:Kɱ%(yKn{ C _ٺꔃ]L~qS!4A=;vJSB\\({CL6lLr6K\?4'H68,~?E;*JP=r i!kYQ``o6P4p0A((wna%]}F[BA Kj$מ ) )pR&N I$PTI&Hh$I$|JCJI$4LSpI%0M RI$(LI8;V j!JL2PU *{L:utIL;B7Y G)$LdRI$IRI$7)I)I$I$RI$ JRI$19M%)$I$RI$D$$I&$$IҐ:JRI$iRI$ SI)I$Z& IJI$$BI$$I>I)I$hKbI&rA")I$ @ :(hRI$) NtIJI$9)$)$N4M)LBJRI$%)$HIJJRI$IBI)I$I$RIJI$LI)I$I$IJI$Gy5C<ߚϿXUnXCtr?k;N I*ˤK> 1i_ϛIC7S5:f&ITf]$N:HI$dRI$I$I$ 'j@$Ic@1J;$SZaN[IDŠR;4X&ḓL"T L+¥:`1JS(IIHH+$Je Ry RI$t$$I'LJRI$$$$I$I)I$@'I$I$I%)$I:dJRI$iNTI$t!JRI$IIJI$I$)$LRN|wAJI$ QIJI$&LI) %#qJRI$K1))I$mƒ$$J$$"I$dI$)$I$IJI$I$RI$INs qRI3$[];n(t{:i c')_fHǺ[Yϊk2d4#bXC`^W?A;8l\9Y^r⚿D]T0@ pvoIC[]$O^:ϣx.tjZ4o}=T,bR$7%+[]tjt򓝤 TJL \_G NꋪwN+Z0iFNySR "R! :NA~^F3n tpoPl.CkqY2qQk ϩv{5.ڙh%#h"pѪbCk=bѤBZ`|[u:XsI^h <υ&"AE_px)cWw$XC,gA/P., ˠ$y1|ԅcT@O0&ǙsUd'~'6Gܓq/~<8O$&/њD7@0Zno{F߿u$/Q3HSXLITj]}_U@k_wxQ%3 ӷ}|\]qQ}'Y64cc^;XZ ]>SԳRU$'L{d@um y;0>}]McsXk@OTj68[h>wNZJpxqUˎL`Cx|V{w]KF Gn`poc\jF iCI]+VÂnϥC SW56{IJCT X|Za#,::VMv~AZ$6#L=sun7!_WV!&\lqcKLnLʭ}'A%24koMGPdm4ʷ[/xo7b?٬rTe@C]'A#kRf!24}I>H͡DI*srJqLHxjSeOL.ֱW;Z+O{2I)rֳG7(Hmihß!71fXg47QmcsĪXrY]r?oII67߸Liu~!@L%LMۜ|@"VnU3[uG_02fX^$OH(Ǘ! Av2;%/щ^<ˎ)_Hi<a݈Kxv;۩% 6 t[$hsB7DuDwq`p4Sm?57TZ%s|B$B&q/:Ԕӱ7قwaRk7e}/W>+\6ۨ{Cէ^;T\Uc=c rWjcZJs+ w;p5cW?FG#?:Ǧ,#C5ZL F/1F/Sn/>Euݍ^@@4_wĒRZ7-TMĈgɘ3VR[IUc7v~VIH:sDs|BAī#[#j'3y-x`o:9?4,uz4LtGt ,KZ?O, T0֏U]n@?g-+fn l\{ \A[ZF$B>KYO-e-kh=9cžDNMZdW{wVg${}C3 !5NF)YasA{ 8!`?n9iVPoîN8h,ĒfGcAIj< D>m$*K4t!f?$cS{c1V|*gWd[}c'g%7FLckn<S6N. m|N 'Rjl,+?w Ȩ9?P}9nĐ˚6ϙC{[qI=#`g7 %A ոvXsSXe|? Ń$Llh:wCmKoihpC6kO(TtgoW)ɪ59-[#Uqst)%wA_?75@Def܊4yjw$`1@>?gϲm̤nW6_}15e.%0I/0*aC$qGl*l?`Jڛ{ţ+6ʄ.kRRႣ.w/3}҆֗h*^[jUn?0jiSꘄc˞^f+45Խ՘:y6~qπEƳTq.p{Cp^Fq,R6㈾hgd_wY" JZ@ {JoM3[wI8Cs txWpvVCyN("w{]w$ߤL\5H 1\|8W!%ή2f;euywG*ѥ(,S٘ޝ#Գآpk%e` hUhvAw5f%X؏3Ps2u>jbjcoܳ3߈۪ 0t [KS*7AblVqacd%k??m 9WoɫM<s_lz,?LUF TڹJ-ܤlc0짶診6CsKL8B5d6=QPoªB6W@}1oI[.9H|)23D6oUc] x7ުoی]f{O޴jm`4y$nq@s̸ʫKut7U6`nmURddW>$klIqڜ<9{Nޝ`g޳nSc {jעP6 *7LXI oVrk 'Ulq~ԣ _\70$*cyҞwXndeQ\?k$sKL8۞90ӑSI,?SNV7?ghΦG%Fmw㖻B~-W+ѿa_S$5:fX}jK,`ןnU#nRSt-xOnDx%^h]W!z"n~g'#U@>=R&T8G-0D$Dr p*J~F?'\zˈto?x^Ok|*qDJ1 :4LYSݫy7m?!>J ?j/.4 VuA }+npoPRnԖ:JKk$=֡nO3@˯5mp-wަr21ggz2k[Z̉~JP2CvhTv-neKe+mV-[פ]8Iտ -01>-WUӳ!yWcQ#P&!N!\`ynيa礥҉K J 5vWck7D s-;o-6gi̻K,mm5= }X=߼urHYI6,?uM ׿<5Q,-x:+'es8H(쿠ؕ2Av*Yĥ~ >qBMMwMԪd|pt꫎GIDhp$K~{>tH'T[ѻpcU㫿BN vwO},<U& |(Yc\x) ~)zLn(S}wո8y)`$,$:&JR_*i/q_DZv?K}3sc4G}܍r$",◦ןѝt M4~)zvP!폊N=%[n=MZƀv%y^x%H>g-?TSuh#9[?^UN$3eu aRo?mi ̲g"Uƴ4CD4@ CUD׌ݠh^bJdlmzW{R}a-mBl3&F[h;7xh*s{\܈lFcn{qэx~{lg0nZߥ?[3{,MHO?E7?IIIIaf߂v5cHAu~r/{|eM̹~"-[vpMP݊ ~7͇JӍŚ,v!KϓTl#=X,`xN׎Zy m, l4cEԏu!#qqQń=~IM2} CՌv<4}"eS/Adt=|-[@:ߣJ鈫_UAmΑ?* l`%_۾=}CMP2m.EI9%LdNT _| =30?jMmf~1@2uPVaEͯA튴t2er Y,i#飷!ԝƼ8}oSά6pkaQScs<몉n-kx$۲fgǸLK\+Ggjg5.V}]}Ǒ4}{H'Gfi) MĩG}UdE?y߾}F'MV PQ_tY%RDr*#Tꝯc; {o? V:^Da8N9EΝJT+k>@"{7;Qika?uW\ڛ 1i_ϛIC7S5:f% 2$IRI2I$I$2I)I$JN&zEtTI!+x˷x*C{I@;$Z܆ rTl% R.P&S)HZRR)JRI$ڊ|P%$YN)I$t%)$I$IJI$LI$NIJI$I4'IJI$I$JRI$:I$$IӨTI'KA)IJI$$$I$BI$$I&I2JRI$)I I$I$RI$I:JRI$'$I*I$ d%)$PLdI2I$I$I$$I$skD[ &>G$-I&>K ߙmm0m<ڴmY414@C~{?Bi%U[KՄUyg;ZO`xnGy@fi؀:3\R}'h@fiǨs]n\8!G 5v>"}~:J@P`XO61\Xx`տooq\lsy)t Iog4qv+4]nY{P/y hUCVs+?_i)&P|U.;Z$ ]H pԶC;cnis{'gD.pXow!E3kk{?1%3/ \< F[`.|z[oqPv״k8VYP>h?fYp[[-^iK|Q5 -BL'l8Ku \Kw8vO;jJ @hfc6==QqT`k:<ƪ|tD6CB.~`"# ?䒘< xv fQ%ǸHĨU[jhc4)';m jN\IyID9I/08|0UM?npcVO%MM5 D_+d?ҥCO ??R$N}}aUkZ!878s['ʯ FHkFIe4%2F~:Lķ\$?b1l H6<\˞\Ѹ 4죎]eہ!CIMkLaٌgwÿ1E_wY:+ek:othQ}V٥_ G~PU􆝊3e?gV|\̶ ok3J!TحǍ%S$Z="]Ev~r!Ǝ:OYDqW~@&ꝺ.sM#v#si% RQۣ7E7vw5d4 }םwΌQ?؍vK${Y %1sκ?L0M<)ztGHd}'d[ԇ4h+vj,v]'Z y?>F-y#58hm$Ƹc- [- yc>ӡvD{cK^iLQv~?Hťda:=Z9FX5e%h0C(߼?meGaC$^G0NV8\>gff]_/ϧ]IΜsCo7W+V/*M4oAw*MR6'51{{G\&4ﰛRCZ7:ڤa˝ccE%qcqg1$16hJG%9va)4pmA=SvOk 2+URjH!r|ΨͧvL ~mҦ7j֧z}/XFc.; vGCǮŃC-S^Vc|G O- aOo!lGx>#J uA`-lVqȋs~ZHL{eFv}5IOy~'j5:[ haWxZl6h;PPUUloJU^w8Cy9<dc$n$s0:{Sv$OM.3?~Excv?T~{Ņ;)$$ӳcY[\xI6hFP g|Ћ=+;Z J$5i)!ôw'_R^x$(<-t;OP81Icec?D@kyGjcAz1}wTf~0c7~uC S{ 8O#Fl!]ԛ orT k]dzjM~c픽݃OMFUY#N9Tu@pI*`EchJc߈I#ϲU!ѷelocYNl[5S+m9iT9%M Ĩc7{ZoO{oӷHw}+@V<Rvkoxw)znQE(6tK\ݾК݇^\8?BnNaE"Y -v8p~էC6@`T"G䂤kFa?*>Oj4Z0}#[o?:v+cև?qo\wo?oIK.sDX65(ly )v67"m`VPiwp5?Y,iiI,I'SOXý! r># U MF;h`E(Vf1<?1%l+B^ k./%䩶}7?/zGv3: Σn;;,t2VF5k{ N=t",Ǻv׷s\Z?VğwAA:ϤePDzM}?ՏFݟ=wm|{lsn~tsG$6-kil<(z~]Pc?Q7cvJ|=@xcͷ&Q?gp!+8 :oc{v}ITnۻχ7DzG}ZaVUѹ߼qFUv>:zv[I)M~)}8 I8 *k+!\{ e`"m;(NN\Xe.0$$aRϦ9?~?}I4?Qm*;p0Ba{Tiw])E]mXGOv-ymV.F>;o-iQ_tzXlic9vXZ^$I[F6|S{|Bm- O))!ߓ]'iZ78e*"uILFc#F@uL^~fӏW '-=W99ŒZEsz+B ;.yȗdW'e$W%O77zt@> V!`ET~ȪюIQ.]׀?,謹Hwb_`~>?_))5<OsLW?SDxѨ=/1xƳU/Q6gEiG]'N$֯'c 3rv?_OBCl Q}1^;oF*<,ۅ/q8_s:K;6@v *#ܠ4mFdYVט>5h5kxD69;_ztm ^3ӝC1[Hm4'f]…6kL\F%}Ow-vXKLYOSeV moN˽;AwA+zӱ*g!lߺe_O;?@%]>cVM^8KL'V*³Ƴ? %6G%gqEIvǸVxV[靹Mc֑F+v%X BˆN v(U_6?D^##67kҩ)R)p!"c4|]Mn/ѻOʳ&rëEM??D{X|JJTxtݩGj>]4h%Q08YYkI- tVn$EvL[LnOzH["j#o(ADv{v3ݑcrG7m?ϼg"O-`.ӟ2Z?ԩ`L~=ۿ=_JY#^d];S9vHAT®כQ+hg48yOLoy?KēSqi\:Aqt8H5J'n]!_"ۺ% F乎q Ȅu !Xx@sMf Uk < ~JhssR6j@hDm~@:(;5;jL??2u%>N/;RG`jQ﹪/;GA6 g;I] DOF,7ESzR2=1A%yuL'$2ѶxOAn5>~IX?}K8{8rhl{tv9%y#%}?k{&l 8D{~8C9;N0uv[˿).\wng<i+m?gi+͗8?B<*2}1]pȣ[jXGTz[wJ]~+.#@N .2L4|-,]t* o㸍Q(phjGLdx#QT+3Gȴfy ?]2kjxe[~HI(3R$x2YDn>tp^>zpsYܻ5?OƑyܬ+.}$-3:c" I7C,j74 ak8N5AjRjxCͧO*#=Jf?I[% }*t杕:Ϣ>h1}Cn}џ#к+E$ dwA*>`Dm>J*-iِS+`3׍ߊ mD~뵬c R KاnBMkۿrXŵ?_[DǨC?5=pU#}C| p0k7{Z6AXd;f#Kh y!5*oG?檷oMumH8L$gZ [[`>64xne-cGYYU TO{4?=YTzͶ~I7{!:%;CDc*. v(}ܭ1)WZoqGVӤe6m:^'<,,0]hv15Vv?noQ}% c6Uf 4jlv>Jha@T)ո8y&4;ϺZwcyC`m礟6Nc|cϢaI99T[;u }#o?ڤΠv^ OwzYZ 9 YrTwsM$+{tKpIfxT"mIZ"=7U023q4x](8]?7,>4*(f;vV ~_!eg{ !Ƭ0GҰG#ba%I>K.2SYd CtormG SflO?7r~;R߳b%M>~N) ]vKEQ$ eRK mpE;\}4FC)ӖJѲÿܬ([My ɲM夕\ ;?\Ze8mG?Vm{m 3 8KZkQ I^Lh$6N4rJ?Pk~mOK}SgH'Vr?9$5zO?䱶oN 9Eôv0'ҙGZ'wX0X>u>|T6Ȁ1zv6 vX4~۠qŸnqSwgա6-%u0 z\*lycjIXqjRS,\-?5B!rQdžd?ǫ(9Y4ش<7RqaӎK;)W[>~Jz.糇zccqC,^bc ik?Eo_M̊Uv[{ByaӎḀe>Fduˎ(Z_a dc^{mtƠcP2;{ ſܒX?CǀEn-c"ccmb7u&?C\oiw*C)UQ6o|=;$Ukpwa_{f>[Zw#KnGhQ-8̟=+S74v*[oԽ=kɧ0 +;&w8hKȾcYd1Z!%.C!ݻmf_Dz'?՟OOi!՜t@EMu 6wr\UqCݯq|m\Ӳ[8s\5bf>?_|IMSVoWÄ" S??W:{,Ov,R1պΎi?IbV@Ѿ}ߝI,d;0,V89V%W8V=;SogU߸^#wWӃ'}8oJEg~J"4->?P~ڇ7Z=y'wh_W834ϼkxQuv{VEXcYջ ?BͿhۨ)yN]W~5a8Dޯ8xQi1($|B4TGk(vf5>f~t.]#yww?-%4w"ǩ :kJþ )nTןkpwU7QgCKFQEN>%3 TAN5U&kUr(uGiZ0ߤGE&=uA )(źЬМʴ- ;*j, "x۲fIJI$a(NJI$ )NRI$D0S;N)I$x!XEqܪD]iHRdZr4U:Gvw*$uUܬנ*M-褒IA(NSI$r%)$M I%)$I$$II$I1I:PI&I$RI$I:JRI$$JRI$$%)$I$$IIJI$I$RI$'JRI$I$I(M IJI$' B@$$JRI$$JEHIJI$LJbI&I$BI$$I*I$I:bI$L IRI$$JRI$$IJI$N%)$-u6٘X8ʷz>x4W4N;?ܰk&!4w0HkGbISe]$_ -i_ϛIC7S5:fUYI$ )I$I %))I$PR%)$N9Og {x@)$CZ?EgP)I%p-RQ( I$' IRI$42RI$BG!JpGE$K=0I `RI$A$JRI$I$I$RI$I8I$RI$IJI$JiNJRI$:IRI% R%0H$I dIL$RI)$I"H)I$dIJI$)I I$I:dI2tE*I$O RI$2qŠJRI$7I1I9LHRI&I̫u qW:D2FսOGf0gO!bVD^.܆ק'*<zgFu=uVGa$5Qb9ٚr}_.?ɦߒmhָw:)lAO:O[mӨghkYYa{ J+ìh/ 씛y8 ˃eR`$ny50hd~Xc!@tRoÿo%ĒdI\xYa6},W:c?t_ԜbV9RRdhGtaq#uxǸ !Hy;ƥ~sOdQ8\n[g(}}2!7w  GVM}0A=";ST)p5' ΉFZDX#Ç^~4Tߤk \49%_u%&XӸr7cBkAu r- Tsʿby1Vbdb5sCG#6'G~w# )n?y;R[~qO{x(a vw?HS۱X!'RNq݉U( 6mEnI,f64πEs̟e;m}z~i˪W{L}:skV6膴r1E~hGyILk!\tNjxp,G?>pka{O?6۞4>\X?~ I#WP[?=ORGNѾO;Q 0K'ܨH@'y[wpyN,WIJIfɓLO(JB];Y1zO?}lɲDaOk4WQfGp~wkvl"6fzH1Cpv{QesvyU3qH%qgkVth3/-7Ysup^9GI)=9ͳhn*_VEKiq<^hU1i5H Ƴ?kɧj#גvP5VYkۣ\DyxOVNH㹃sXeù?&)KO?"^rx~UwrMnV{4AY=' u;L^)רOtbv9pп-SCZ;]5?؜:,?y )`=-NQe,5Z_]Wc]:_g;~6sViy(̰!p; m7&u'ϲKl铹n2lh'yLHvk+I7U&5dD4( h^!!\"Ѹ~OYӝS$@ _ۿS$-6,~sF4.efݎw5Z IS_O3R̷؝ xQ|y nU?3nQ'5r].,]X[{o>'F.y?v?6(27vwѯ઻^Z6۷=XƮ.{wv'} 4@ YRk{]0\X'(vX{LJsY.(p]o`yek?i7#F!ԝ"<>5fjRF^𥵖6aߺB5f5-?Iq[hai)m.{3a%E6cMub-9;+!?Za.EZmno-s1sdOnXk:o2j`~Av ۥcr],ZZw[ ;Fi)Ma#s\3Jx u\w8L0I崲I h_Reѯ,xxIUl Q~}CoW#m~r9d"w m)UleYBf KNUS|P^MgkƿW܊ܲѶT/^8{};󿶇_I_FpZ(ɲoec7 )r\ OcTe͝&Z ̞<΁_[ֳ#La Hj!(ei^ ;9%%% NBV??Dq˹'k?A:_ajkM'wXlH<ډV#*;\urIL.c(1im&8@D_q/(ˮv95>9iJU'/e|C~8E'dcއMs:{Q$2!5o^bߺxː:n) $~R/3}2&UkcG?yw`\l'%8 տֳR~k 6;Y3g%:?s7C 0uv[x0iXҪV5Gj$\<9wqEWa @p~%Y G8QV!-%$S7R j%UߣL;\6eZ}gQSku67xY(M[5 ՊEoOmʛcvXoTCXsorbk}?Ma"8I Zӹ3- {Cr){$ԩY2^;, hrU-lIahJKm|_%3}qmB\?9ڟ:8y^ 594s1zWeWI۫ϤgOEH\WG %t'U_G:7k~Gq[UAςF-x+lO'$%)evP-V6pWg;. x \:t:=⦅]U hѨTW~0:;KjmcCPn|0uvjK;]U pZ LScpF!L`*95ـ8pþ;zxq]ο@R*T$hJ$#$6sr߲4(N,7˓Nwa! ɂAcAOy]aep>)߃GvwN]@ ٫I*8 FN~…9ޙ>9nQیd;#뿤8~}Җ+ ;*eXASdD(ˉ'ġaPnê8pmY%%ɲtӨU'ܩy} [kmn]sɭ?r;*p?fG{qi6JϋuoIJ<[wmμ2*vP˛Ƈ4:Ykt?S{Gʦu8}`]If̴YuRve]ռ.{l2|ӌpCO$skÌ1(v#_;D.ʕt` w'pw*lΰ ;yW5d/гkaЭ:ֶÏ\nyhDJlzՠ#O4;2f:xvPMqk;lyKj.PRM"lKzmk<_o\w{𕫦%rM1ۻGFi);l-2AESl|I1.0%X8MoFTPi{Mn՟'P y~L$f]Qh4p‡g;Ҙ喍LwYeV1oDFWOpUn0`%@teKx:hw*{,c0Us^=N*.ʬNG{~ij#\{q7ooF ?ѽ8jC!25sѵx;Tj/SeMm` oJc.*[PR.2|Jm65x em^QvZR7X@ )4זi !oS>*3Ὸs?+L3[2jyui263=حN*;̽J(l}>y~ ;:i6e9hF A!c#1;}7ŭʆ,am8"cS {F=_Fu*oƹ&?pZ]XCt'I)% eq?$ʟaRFZTc ڠz72MjvtNɵ.#}cJD_HllMۏ&N>@n;DzQ۲P-%R܃J^Yqjf_oW%RYF.|=U=DE,=(2,F]kIU iE ۙƾǏ?F#ճUz;38J+3!APS+qkei@PFϹh;JGr_+OK|JT߇?)1o?5 ->'j'li'>jfhO=o{\GŬ@%T9ۊggQQx^ooP?֖hV$_Gn3˗&}ҫ|,o3~}Tj@$m}KujP.2|$\dU4pP},s<6ԕIj}Vr6;jU]oRvMv~7Ղk )emj1v_礦˪s} uCmņX`2ay&3CG;Zn` iA:R>cnSQ)ױG$&^]Ok$nhC(wP*vkbveT^omY7H}uRAw;O^w%njlQujf"yrM4?8KE&0-:8aȴˆpQ18hW$SUѻ`>\4!4s;Nx*4@"dȫM.*~C8't +4`UAj:\e=l}0ODW)̇#_+'zL/TOM-&?y]AJv}U[IU6ګn| *}:#VveX{\iZoO+'K<=mX=Ǘ\[AQu =Tl㧀Y' kfCzV}[;_kZP/㸈x椪lzt 'zϰ{\67qr!+fCvZd378(.g=;AvIJa,2AEXVP?)[uo 753%+\R}akخ5LV=Fs|C:!h|B/wihÒ#WK`ʬ3E^ܡ]Eߕ3v?+ILPjCR?:dVu hU?]=D׻Լ_?sod QM,kAf6lo!n6?LS"6kk?FUX:ަV^E$i,H yw#P:Ϡ>}ȪwN꭯k{3oj>l"zޓHik{˝},,-I^jj yImrjy @8ѽoAO!v?ʥ {v'=9ԷK~Mo$Gw/PIn ]NjuxQ e`飐2G˞xh)sC.Ce-Ku!;+6 7wɬoi3ߞOylܳ+_jr=l6ost-I Af}.?Ru o?m?Yɐy:oFGͳ7'Z ~EUvPM.DoKmԵC jJfM-;G-oE=GTَ{(4hKuClW)42Ѐ̧VO$m=9Za~ /ڕ#XU<; TZ@yЎ) -ng5`טҮ$Zu-{lz;KO!5fVxsAmʹ'3gF/,pk΄,ԟ@e/??6D:xHu䩛OA#~jhw5;0#~{ѱj/v?5ux#@cG6>[h:-u |yʛ1}j>;m;mM=-g[}Go7W|$ &$jh{wy1(m;rUE:B=6>bN1ԟo-}&'v3;$%u-.-~(5o#*Yh)_wN2]Qٓ;I=YAdsOo*=9c/$n^vfuNO=Sikb?S88hoKMTG?!ZЪP֎%nFhƇ;92%TTui&aɭ;鶌X-wI cڱ84jC2Xf`9$thV溷4v6T>=uu1q:+300;Ͱ`UKIsI7~y/ؓ2,ffC?،:R4Ys5 NuaAi1bp=5(cb;׼}ܭ TK]{=GW2$G';'.c 0Dk%埘$^H5kw#}v̇>ILΏ$:v!E;^Yƣ(1f?җ؍^g nktf1Z˻!jyH, UՒ@pmi!ppR &M֎eG7xk--25C}'w?{ߧ?;X*8AmK&|gRWλhh)T 9QҀɔY8 s1}'=!Z@5I}AԳzJ8*>ϿJC;IUmvߤ>Ojji50We9eկn^1܋IjJdqR/ǟ4ۖ6% QxtPևXuߢU?cxwj60vqT2r=c]%x"Pp;!>M8 Ln]G%Vs+)t4{"j)]?WMn]ڧUw?-dB4#`#GqvN$ջAomp>-E7҉Tks2G`;j4>!Z@ Ӳh~;⫑`j^{Z?yY%qW=& ';<ʓtw)ˉx RэG?)oƍ16NK4D~bvG~bJg3ܐy(Ox ˤ_dO!JEֽDӲ~i)} ;&@:kQhe.a-~uKs#8jow#*低54 3jIy jM1h:‚j,ѣs-' hnjۤT$4@7n?t_ܱ*u,:$x1t$FY~IL% Rk9l0;gM ]kw:)\DCN0–-k1_X:Ljh Wc!0b Z5~Q[K$2߹4'GR&ꤩ&Nx&N 1i_ϛIC7S5:fITf]$I$IJI$I$RI$I$I;yR~39NpI$ Tռ3E1I$dBu(RI$RI$I2d\$J.B袹 Q;)$TJV$I $$I$]RI$I$I9$I)I$I$JRI$I%)$I$IJI$2I)I$I)I:I$I% IJI$v2E2JRI$PI% 4$TI$PJRI$0 BJRI$` )I$NAI'ĸ $)$8$I}{}Li?DGޗљCZhZJFVӵߔ^a5WTsUu:^vkw"۔\h ߧI ?Rw8%@Dz#% tefCZif[~@e#b#mȇxk=S'ĩZR-c7<ҰKIJ[Sx{SG M^hsVSZxIJfkǴhS|yf;Hs(lX jAФK4Ty';&S%No)JU6\;iMg&\;v SVT,h墷ehc'i-M1מ_􃿶cmCIF_$IktaZ vۡWUG' [X"4=Ӓw;Jw#R\m ҂;)5Vd;+*~jnWTtq٣n} ӳcj⒙upxY0/qǹL@g_C}{]uy{@C"-$~!3\ U%EolŪM<*}zK 249#Y#tQ35?II1ͿSpQ40D~D? ٿ.3ܓR> X^n#acv@ coNo}M8Jl;mtw:}Hl 24Sn]mK78 ;{ q0wn!i͎wn|KnvA4ӯg<-%l)\ZɎ-þOR$8ܡ ?96]kG,eeNx}69K{j[RU6}=?PXO~*¯VG:A_:Dy8|0C̓[qKup⒓[cOC^&|jq熟a>Qghc#hnr슚$U:u4L4WS۵IAm YLfam#۩UFKwU2gQî wJ_Z?<#k/ïq$U?K ^?Ju&4SIb[K)L66H*hvwo+6JgWhbWݬܢvX&ւ>҂ȥk|n[2Ued<2ϒе{r=ې-ipi$uux#asƍ<*ݣF`5Վ%i!}7IU%j&h~Ý6?l =LW1U)?!7;ߒS*̎㲱um%T-sEB(sc''QoHVb< ]A;DڅgӭG?e4|yIIܦ2ې xmHX`ÄHB!;[Oq.w`}8/Uct5wK6iKd~ѩ muyRSk-Jy=D*mHgd